Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 19.1, Problem 4COMQ
Which of the following is an example of a somatic mutation?
a. A mutation in an embryonic muscle cell
b. A mutation in a sperm cell
c. A mutation in an adult nerve cell
d. Both a and c are examples of somatic mutations.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Which of the following terms refer to the case when a mutation results in a significant decrease or a complete loss of the functional activity of a gene product?
a. gain-of-function mutation
b. loss-of-function mutation
It is an example of natural mutation in cattle that enabled the creation of breeds such as Piedmontese and Belgian Blue. SEE PHOTO ATTACHED
A. Myostatin gene mutation
B. Double muscling
C. A and B
D. None
Which of the following is true about the enzyme telomerase?
A. It is found only in adult cells.
B. It is responsible for telomere shortening.
C. It can re-establish telomere length.
D. It may speed up the aging process.
E. It is expressed at low levels in cancer cells.
Chapter 19 Solutions
Genetics: Analysis and Principles
Ch. 19.1 - 1. A mutation changes a codon that specifies...Ch. 19.1 - A down promoter mutation causes the promoter of a...Ch. 19.1 - 3. A mutation in one gene that reverses the...Ch. 19.1 - Which of the following is an example of a somatic...Ch. 19.2 - Prob. 1COMQCh. 19.3 - Which of the following is not an example of a...Ch. 19.3 - A point mutation could be caused by a....Ch. 19.3 - One way that TNRE may occur involves the formation...Ch. 19.4 - Nitrous acid replaces amino groups with keto...Ch. 19.4 - Prob. 2COMQ
Ch. 19.4 - Prob. 3COMQCh. 19.5 - The function of photolyase is to repair a....Ch. 19.5 - Which of the following DNA repair systems may...Ch. 19.5 - 3. In nucleotide excision repair in E. coli, the...Ch. 19.5 - Prob. 4COMQCh. 19.5 - An advantage of translesion-replicating...Ch. 19 - Is each of the following mutations a transition,...Ch. 19 - Prob. 2CONQCh. 19 - What does a suppressor mutation suppress? What is...Ch. 19 - Prob. 4CONQCh. 19 - X-rays strike a chromosome in a living cell and...Ch. 19 - Prob. 6CONQCh. 19 - Prob. 7CONQCh. 19 - 8. A point mutation occurs in the middle of the...Ch. 19 - Prob. 9CONQCh. 19 - Prob. 10CONQCh. 19 - 11. Is a random mutation more likely to be...Ch. 19 - 12. Which of the following mutations could be...Ch. 19 - Prob. 13CONQCh. 19 - Discuss the consequences of a germ-line versus a...Ch. 19 - Prob. 15CONQCh. 19 - Explain how a mutagen can interfere with DNA...Ch. 19 - What type of mutation (transition, transversion,...Ch. 19 - Explain what happens to the sequence of DNA during...Ch. 19 - Distinguish between spontaneous and induced...Ch. 19 - Prob. 20CONQCh. 19 - Prob. 21CONQCh. 19 - Prob. 22CONQCh. 19 - Trinucleotide repeat expansions (TNREs) are...Ch. 19 - 24. With regard to TNRE, what is meant by the term...Ch. 19 - 25. What is the difference between the mutation...Ch. 19 - Achondroplasia is a rare form of dwarfism. It is...Ch. 19 - Prob. 27CONQCh. 19 - In the treatment of cancer, the basis for many...Ch. 19 - Prob. 29CONQCh. 19 - 30. Which of the following examples is likely to...Ch. 19 - Prob. 31CONQCh. 19 - Prob. 32CONQCh. 19 - Prob. 33CONQCh. 19 - With regard to the repair of double-strand breaks,...Ch. 19 - Prob. 35CONQCh. 19 - Prob. 36CONQCh. 19 - 37. Three common ways to repair changes in DNA...Ch. 19 - Prob. 38CONQCh. 19 - Prob. 39CONQCh. 19 - Explain how the technique of replica plating...Ch. 19 - 2. Outline how you would use the technique of...Ch. 19 - 3. From an experimental point of view, is it...Ch. 19 - Prob. 4EQCh. 19 - Prob. 5EQCh. 19 - 6. Richard Boyce and Paul Howard-Flanders...Ch. 19 - In E. coli, a variety of mutator strains have been...Ch. 19 - 2. Discuss the times in a person’s life when it is...Ch. 19 - A large amount of research is aimed at studying...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which of the following mutations is NOT a point mutation? A. Missense mutation B. Insertion mutation C. Nonsense mutation D. Silent mutationarrow_forwardDefine the following terms:a. point mutationb. transition mutationc. transversion mutationd. silent mutatione. missense mutationarrow_forwardDefine the following terms: a. point mutation b. transition mutation c. transverse mutation d. silent mutation e. missense mutationarrow_forward
- Which of the following results in the same amino acid in its protein sequence? a. missense mutation b. sense mutation c. nonsense mutation d. antisense mutationarrow_forwardWhich of the following statements is true about the effects of mutations in somatic cells and gametes? A. Only mutations in gametes can affect future generations. B. Only mutations in somatic cells can affect future generations. C. Neither mutations in somatic cells or gametes can affect future generations. D. Mutations in both somatic cells and gametes can affect future generations.arrow_forwardWhich of the following is NOT true about mutations? A. Mutations can be harmful but not beneficial to the cell B. Nucleotide substitution in DNA can cause nonsense mutations C. Nucleotide substitution in DNA can cause missense mutations D. Mutagens increase the rate of mutation, but mutations are still random E. Nucleotide insertion or deletion in DNA can cause frameshift mutationsarrow_forward
- Of those in the following list, which organ(s)/tissue(s) is/are affected by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? select all that apply a. pancreas b. skin c. heart d. eyes e. spine and skeleton f. colonarrow_forwardWhich of the following statements are true about the rate of mutation in tumor cells (select all that apply)? A. Mutation rate of tumor cells is reduced compared to normal cells of the same tissue type B. Mutation rate of tumor cells is unchanged compared to normal cells of the same tissue type C. Mutation rate in tumor cells is higher compared to normal cells of the same tissue type D. Affected by genome instability within the tumor cellsarrow_forwardIn general, all mutations can be considered harmful, because most genetic systems are already optimized to work correctly and efficiently. A. True b. False; mutations are considered harmful only if they have a direct effect on the ability of cells to synthesize DNA c. False; some mutations are harmful, and some are considered beneficialarrow_forward
- which of these describes the symptoms of the disease(s) caused by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? Select all that apply a. Thread-like blood vessels in eyes b. Excessive bleeding c. Dwarfism d. UV light sensitivity e. sunburn f. Bruisesarrow_forwardWhich of the following statements best describes the outcome of a mutation? a. A mutation always results in a mutant genotype b. A mutation always results in a mutant karyotype c. A mutation always results in a mutant phenotype d. A mutation always results in a mutant proteinarrow_forwardWhich statement(s) below regarding DNA mutations is true: A. Mutations only occur in genes B. Mutations always result in phenotypic alterations C. Mutations are only induced by extrinsic (environmental) factors D. Mutations can occur in promoters E. Point mutations can be caused by transposons or “jumping genes”arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY