Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 19, Problem 31CONQ
Summary Introduction
To review:
The effect of the absence of the following proteins in the
UvrA
UvrC
UvrD
DNA polymerase
Introduction:
NER is one of the major DNA repair mechanisms in a cell. This mechanism works by removing the stretch of DNA which has the error and then replacing it with freshly synthesized DNA. A number of proteins are involved in the mechanism, such as UvrA, UvrB, UvrC and others. This system corrects many kinds of errors, such as chemically modified bases, thymine dimers and crosslinks in DNA.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
How would nucleotide excision repair be affected if one of the followingproteins was missing? Describe the condition of the DNAif the repair was attempted in the absence of the protein.A. UvrAB. UvrCC. UvrDD. DNA polymerase
Match the following type of DNA repair mechanism with the most appropriate definition.
Nucleotide excision repair
Homologous recombination
Base excision repair
Nonhomologous end joining
A.
Repairs thymine dimers by removing a section of the strand
B.
Corrects damaged bases by removing only the base
C.
Repairs double strand breaks by joining the ends
D.
Repairs double strand breaks by copying second chromosome
Defects in the excision repair process may result in :
A. Mutations
B. Okazaki fragments
C. Excess DNA polymerase activity
D. Shortened telomeres
Chapter 19 Solutions
Genetics: Analysis and Principles
Ch. 19.1 - 1. A mutation changes a codon that specifies...Ch. 19.1 - A down promoter mutation causes the promoter of a...Ch. 19.1 - 3. A mutation in one gene that reverses the...Ch. 19.1 - Which of the following is an example of a somatic...Ch. 19.2 - Prob. 1COMQCh. 19.3 - Which of the following is not an example of a...Ch. 19.3 - A point mutation could be caused by a....Ch. 19.3 - One way that TNRE may occur involves the formation...Ch. 19.4 - Nitrous acid replaces amino groups with keto...Ch. 19.4 - Prob. 2COMQ
Ch. 19.4 - Prob. 3COMQCh. 19.5 - The function of photolyase is to repair a....Ch. 19.5 - Which of the following DNA repair systems may...Ch. 19.5 - 3. In nucleotide excision repair in E. coli, the...Ch. 19.5 - Prob. 4COMQCh. 19.5 - An advantage of translesion-replicating...Ch. 19 - Is each of the following mutations a transition,...Ch. 19 - Prob. 2CONQCh. 19 - What does a suppressor mutation suppress? What is...Ch. 19 - Prob. 4CONQCh. 19 - X-rays strike a chromosome in a living cell and...Ch. 19 - Prob. 6CONQCh. 19 - Prob. 7CONQCh. 19 - 8. A point mutation occurs in the middle of the...Ch. 19 - Prob. 9CONQCh. 19 - Prob. 10CONQCh. 19 - 11. Is a random mutation more likely to be...Ch. 19 - 12. Which of the following mutations could be...Ch. 19 - Prob. 13CONQCh. 19 - Discuss the consequences of a germ-line versus a...Ch. 19 - Prob. 15CONQCh. 19 - Explain how a mutagen can interfere with DNA...Ch. 19 - What type of mutation (transition, transversion,...Ch. 19 - Explain what happens to the sequence of DNA during...Ch. 19 - Distinguish between spontaneous and induced...Ch. 19 - Prob. 20CONQCh. 19 - Prob. 21CONQCh. 19 - Prob. 22CONQCh. 19 - Trinucleotide repeat expansions (TNREs) are...Ch. 19 - 24. With regard to TNRE, what is meant by the term...Ch. 19 - 25. What is the difference between the mutation...Ch. 19 - Achondroplasia is a rare form of dwarfism. It is...Ch. 19 - Prob. 27CONQCh. 19 - In the treatment of cancer, the basis for many...Ch. 19 - Prob. 29CONQCh. 19 - 30. Which of the following examples is likely to...Ch. 19 - Prob. 31CONQCh. 19 - Prob. 32CONQCh. 19 - Prob. 33CONQCh. 19 - With regard to the repair of double-strand breaks,...Ch. 19 - Prob. 35CONQCh. 19 - Prob. 36CONQCh. 19 - 37. Three common ways to repair changes in DNA...Ch. 19 - Prob. 38CONQCh. 19 - Prob. 39CONQCh. 19 - Explain how the technique of replica plating...Ch. 19 - 2. Outline how you would use the technique of...Ch. 19 - 3. From an experimental point of view, is it...Ch. 19 - Prob. 4EQCh. 19 - Prob. 5EQCh. 19 - 6. Richard Boyce and Paul Howard-Flanders...Ch. 19 - In E. coli, a variety of mutator strains have been...Ch. 19 - 2. Discuss the times in a person’s life when it is...Ch. 19 - A large amount of research is aimed at studying...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- All of the following proteins function during nucleotide excision repair, EXCEPT: A. DNA pol B. Uvr A C. Uvr C D. Ligase E. Gyrasearrow_forwardThe general excision repair pathway for DNA repair has the following order A. endonuclease cuts → DNA ligase removes → endonuclease removes → DNA ligase B. DNA ligase → DNA polymerase → helicase or endonuclease removes → endonuclease cuts C. endonuclease cuts → helicase or endonuclease removes → DNA polymerase → DNA ligase D. endonuclease cuts → DNA polymerase repairs → helicase opens up → DNA ligasearrow_forwardA.) Damaged DNA can be reversed if nucleotides can be replaced with a proper nucleotide for a correct amino acid base. B.) Direct reversal of DNA repair can destroy the abnormal bonds of the nucleotides in the DNA sequence. a. Statement A is correct b. Statement B is correct c. Both A and B are correct d. Both A and B are incorrectarrow_forward
- A.) Base excision repair requires polymerases. B.) In DNA repair by excision, the non-damaged strand is used as a template for a new strand of DNA. a. Statement A is correct b. Statement B is correct c. Both A and B are correct d. Both A and B are incorrectarrow_forwardWhich of the following types of DNA damage would be hardest to repair using the DNA repair pathways?A. Complete removal of three nucleotides in the middle of one strand.B. A covalent bond between a base on one strand and a base on the complementary strand.C. Incorporation of a sugar other than deoxyribose into one strand.D. Covalent attachment of a short polypeptide to a single base.E. A covalent bond between a base and a deoxyribose on the same strand. Please explain why it's Barrow_forwardTake each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication Complement of each strand ii. Transcribe the complement strand of DNA into an mRNA strand Translate the mRNA strand into an Amino Acid strand iii. a. ATGGACGTATAGATGACAGGTAGATGTTTCAGGGGGATTTATCGATAG b. ATGGCCATTGAGTGTCAAAAGTCTCAATGA First base U UUU UUC UUA UUG CUU CUC C CUA CUG G U -phenylalanine (Phe) -leucine (Leu) GUU GUC GUA GUG leucine (Leu) AUU AUC isoleucine (lle) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Second base ACU ACC AUA ACA AUG methionine (Met) (start) ACG -valine (Val) UCU UCC UCA UCG CCU CCC CCA CCG GCU GCC GCA GCG C -serine (Ser) -proline (Pro) -threonine (Thr) -alanine (Ala) UAU UAC UAA stop UAG stop CAU CAC CAA CAG AAU AAC AAA AAG A -tyrosine (Tyr) GAU GAC GAA GAG - histidine (His) -glutamine (Gln) - asparagine (Asn) -lysine (Lys) -aspartic acid (Asp) -glutamic acid (Glu) CGU CGC CGA CGG AGU AGC AGA AGG G -cysteine…arrow_forward
- Nucleotide excision repair A. recognizes and repairs thymine dimers and other damaged bases in DNA B. corrects errors in nucleotide excision C. recognizes and removes mismatched bases after DNA synthesis is completed D. removes nucleotides that are incorrectly incorporated during DNA synthesisarrow_forwardWhich type of mechanism best repairs thymidine dimers caused by exposure to UV light? a. Nucleotide excision repair b. Base excision repair c. Mismatch repair d. NHEJarrow_forwardIndicate whether each of the following statements is true or false. If a statement is false, explain why it is false. A. The repair polymerase is the enzyme that proofreads the newly synthesized strands to ensure the accuracy of DNA replication. B. There is a single enzyme that degrades the RNA primers and lays down the corresponding DNA sequence behind it. C. DNA ligase is required to seal the sugar-phosphate backbone between all the DNA fragments on the lagging strand. D. The repair polymerase does not require the aid of the sliding clamp, because it is only synthesizing DNA over very short stretches. Answer the following questions about DNA replication. On a DNA strand that is being synthesized, which end is growing the 3' end, the 5' end, or both ends? Explain your answer. А. B. On a DNA strand that is being used as a template, where is the copying occurring relative to the replication origin-3' of the origin, 5', or both?arrow_forward
- Pyrimidine dimers in DNA may be repaired by in E. coli cells. (select all correct answers) Select one or more: O a. photolyase O b. nucleotide excision repair O c. mis-match repair O d. methyl-transferasearrow_forwardEnzyme function is critically important for the proper replication of DNA. Predict the consequence of a loss of function for each of the following enzymes. a. DNA gyrase b. DNA polymerase III c. DNA ligase d. DNA polymerase Iarrow_forwardWhat can cause mutations in the DNA sequence? Select all that apply. a.Exposure of cells to ionizing radiation b.Failure of repair enzymes to recognize mismatched nucleotides before and during DNA replication c.Recognition of mismatched bases by repair enzymes before and during DNA replication d.Nucleotide errors occurring during DNA replicationarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
TISSUE REPAIR Part 1: Repair - Regeneration; Author: ilovepathology;https://www.youtube.com/watch?v=t-5EjlS6qjk;License: Standard YouTube License, CC-BY