Genetic Analysis: An Integrated Approach (3rd Edition)
3rd Edition
ISBN: 9780134605173
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 7, Problem 14P
Bacterial DNA polymerase I and DNA polymerase III per-form different functions during
a. Identify the principal functions of each molecule.
b. If mutation inactivated DNA polymerase I in a strain of E. coli, would the cell be able to replicate its DNA? If so, what kind of abnormalities would you expect to find in the cell?
c. If a strain of E. coli acquired a mutation that inactivated DNA polymerase III function, would the cell be able to replicate its DNA? Why or why not?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG.....
TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT
complementary strand:
b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid.
polypeptide sequence:
does the sense strand DNA sequence have 5’ and 3’ UTR sequences?
5'UTR =
3'UTR =
Explain, in detail, the process of DNA replication. Include in your answer, a diagram, the cellular location and reason for DNA replication, the names of all enzymes/molecules involved, and the sequence of events.
a. Explain, in detail, the process of mRNA translation. Include in your answer, a diagram, the cellular location and reason for translation, the names of all enzymes/molecules/sites involved, and the sequence of events.
Please help explain in fewer than 8 sentences!
b. The diagram below is of a short stretch of prokaryotic chromosomal DNA in the process of replication.
Please supply the specific pieces of information requested by the boxes below.
1. What enzyme relaxes the
supercoils?
2. What enzyme unwinds the DNA?
7. What does this arrow
represent?
3. What enzyme synthesizes the
RNA primer
8. Why should this single-stranded
portion be stabilized?
4. What is this short segment of
DNA called?
9. What enzyme synthesizes this
long DNA segment?
5. What enzyme removes the RNA
primer and replaces it with DNA?
10. Is this the leading or the
lagging side?
6. What enzyme joins the short
segments of DNA together?
3
Chapter 7 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
Ch. 7 - What results from the experiments of Frederick...Ch. 7 - 7.2 Explain why Avery, MacLeod, and McCarty’s in...Ch. 7 - 7.3 Hershey and Chase selected the bacteriophage...Ch. 7 - 7.4 Explain how the Hershey and Chase experiment...Ch. 7 - 7.5 One strand of a fragment of duplex DNA has the...Ch. 7 - 7.6 The principles of complementary base pairing...Ch. 7 - For the following fragment of DNA, determine the...Ch. 7 - 7.8 Figures present simplified depictions of...Ch. 7 - 7.9 Consider the sequence -ACGCTACGTC-.
What is...Ch. 7 - DNA polymerase III is the main DNA-synthesizing...
Ch. 7 - There is a problem completing the replication of...Ch. 7 - Explain how RNA participates in DNA replication.Ch. 7 - A sample of double-stranded DNA is found to...Ch. 7 - Bacterial DNA polymerase I and DNA polymerase III...Ch. 7 - Diagram a replication fork in bacterial DNA and...Ch. 7 - Prob. 16PCh. 7 - Which of the following equalities is not true for...Ch. 7 - List the order in which the following proteins and...Ch. 7 - Two viral genomes are sequenced, and the following...Ch. 7 - Matthew Meselson and Franklin Stahl demonstrated...Ch. 7 - Raymond Rodriguez and colleagues demonstrated...Ch. 7 - 7.22 Joel Huberman and Arthur Riggs used pulse...Ch. 7 - 7.23 Why do the genomes of eukaryotes, such as...Ch. 7 - Bloom syndrome (OMIM 210900) is an autosomal...Ch. 7 - 7.25 How does rolling circle replication (see...Ch. 7 - Telomeres are found at the ends of eukaryotic...Ch. 7 - A family consisting of a mother (I-1), a father...Ch. 7 - In a dideoxy DNA sequencing experiment, four...Ch. 7 - Prob. 29PCh. 7 - Using an illustration style and labeling similar...Ch. 7 - A PCR reaction begins with one double-stranded...Ch. 7 - Prob. 32PCh. 7 - Prob. 33PCh. 7 - 7.34 A sufficient amount of a small DNA fragment...Ch. 7 - You are participating in a study group preparing...Ch. 7 - Prob. 36PCh. 7 - The following diagram shows the parental strands...Ch. 7 - Go to the OMIM website...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Some antibiotic drugs fight infection by interfering with DNA replication, transcription, or translation in bacteria. Indicate whether each of the following antibiotic drug effects is on replication, transcription, or translation. HINT Each answer (replication, transcription, and translation) is used only once for the following: a. Rifampin binds to bacterial RNA polymerase. b. Streptomycin binds bacterial ribosomes, disabling them. c. Quinolone blocks an enzyme that prevents bacterial DNA from unwinding.arrow_forwarda. Pfu Polymerase b.dNTPs c.Buffer Match each component above to the correct function(s) listed below. Write your selection(s) for each component. You may have more than one answer for each. 1. unwinds DNA 2. synthesizes new DNA strands 3. enzymatically catalyzes Quikchange 4. nucleotide source for new DNA strands 5. Energy source for reaction(s) 6. Repairs errors in base pair matching 7. Maintains pH and salt levels 8. Creates polymer chainsarrow_forwardIn Semi conservative replication: A. After one round of replication of a single molecule of DNA, one DNA molecule will be produced that contains two parental strands of DNA and one DNA molecule will be produced that contains two new (or de novo) strands. B. After one round of replication of a single molecule of DNA, two resulting DNA molecules will be produced both of which contain a mix of both parental and new DNA interspersed on every strand of DNA C. After two rounds of replication of a single molecule of DNA, two resulting DNA molecules will contain both a parental strand and a new strand of DNA and the other two resulting DNA molecules will contain all new (or de novo) DNA D. After two rounds of replication of a single molecule of DNA, one resulting DNA molecule will contain 2 parental strands of DNA and the other three resulting DNA molecules will contain all new (or de novo) DNA E. A and C F. B and Darrow_forward
- A. Diagram a short single strand of DNA 5’ -AA-GG- 3’. Show the chemical structure of the phosphoribosyl backbone and the attachment point for nucleotides added as “A” or “G”. B. Diagram the product of digestion was a restriction enzyme to cut this sequence between the A and G.arrow_forwarda. As a result of the structure of DNA and RNA, replication, transcription and translation are possible. What can nucleic acids do, as a result of their structure, that enables these processes to occur? The figure below shows a simplified schematic representation of a segment of DNA. The DNA is labelled with the numbers 1 – 14 for easy reference. -35 sequence Pribnow box 5' UTR 3' UTR DNA TTGACA TATAAT -35 -10 Gene a Gene B Gene y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 UTR = untranslated region b. At which position on the DNA (number 1 - 14) will transcription be initiated? c. At which position on the DNA (number 1 - 14) will the first signal for translation be found? d. Between which two regions on the DNA will the polyadenylation signal be found? Use the numbers to indicate the region. e. Between which two regions on the DNA will the first Shine-Dalgarno / Ribosome Binding Sequence be found? Use the numbers to indicate the region.arrow_forward3b) Briefly explain what telomerase does, how it accomplishes what it does, and why that allows a cell to completely and accurately replicate the ends of linear DNA molecules. (please note that the question does not ask you to explain the entire process of replication of the end of a linear DNA strand, it only asks about the function of telomerase in this process)arrow_forward
- a. What process would be unaffected in with defective topoisomerase? Prokaryotic DNA packaging Eukaryotic DNA packaging Prokaryotic DNA replication Eukaryotic DNA replication All of the above rely on topoisomerase function b. Why is primase required for DNA replication? To unwind the DNA helix To prime nucleotides for addition to the growing chain To provide a 3' OH for DNA polymerase To recognize the origin of replication To remove supercoils ahead of the replication machinery C. What is the purpose of PCR reaction? To alter the sequence of a fragment of DNA. To insert a fragment of DNA into a bacterium To amplify a fragment of ONA To destroy a fragment of DNA To determine the sequence of nucleotides in a fragment of DNA.arrow_forwardBelow is a study of a colony of cells, determine that some of these cells have a mutated DNA polymerase I that results in loss of function of this enzyme. - What will the effect of the mutation in DNA polymerase I be on DNA replication? Include leading and lagging strand - Will this mutation in DNA polymerase I have an impact on another step in DNA replication? Will DNA be replicatation be impacted? Are any enzymes involved?arrow_forwardThe experiment below is from a seminal set of experiments in the 1960s that illustrated the role of various repair pathways for DNA damage caused by UV radiation. In this experiment, the scientists isolated E coli strains that are mutant in the Rec A gene, the UvrA gene or both. They then irradiated cultures of each strain with increasing doses of UV light and measured the effect on cell viability. Answer the following questions about this data. A. Which DNA repair pathway and repair activity is inhibited by the Rec A mutant? B. Which DNA repair pathway and repair function is inhibited by UvrA mutant? C. Why is the UvrA/RecA double mutant so much more senitive to UV light than either mutant alone?arrow_forward
- Generate a concept map that includes all the specifics below: Classification based on: 1. their effect on the DNA 2. on their phenotypic effect. Kinds of DNA damage and lesions (spontaneous and induced) produced by specific exposures. (Note: don't forget transposons and CRISPR Cas9) Specific repair mechanisms that fix each kind of DNA damage or lesion (during/post replication). Include information about the number of replication cycles for a dominant mutation to cause a phenotype. And the number of cycles for a recessive mutation to possibly cause a phenotype.arrow_forwardI. Compare how Bacteria, Archaea, and Eukaryotes differ on each of the following aspects of DNA replication: 1. How do the number and types of DNA polymerase differ between these three groups? 2. How does the physical location in the cell of DNA replication differ between these three groups? 3. Are there differences between these three groups in the timing of when DNA replication occurs in cells? 4. How does origin of replication differ in terms of number and location between these three groups?arrow_forwardYou are studying a colony of cells and determine that some of these cells have a mutated DNA polymerase I that results in loss of function of this enzyme. A) What will the effect of the mutation in DNA polymerase I be on DNA replication? In your answer make sure to describe what would be observed in the leading and lagging strand and explain your reasoning. B) Will this mutation in DNA polymerase I have an impact on another step in DNA replication? In your answer make sure to indicate whether DNA replication will be impacted or not. If it is not, explain why. If it is impacted, then describe the step that is impacted and name the molecule or enzyme involved.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License