Concept explainers
A widely used method for calculating the annealing temperature for a primer used in PCR is 5 degrees below the melting temperature, Tm(°C), which is computed by the equation 81.5 + 0.41 × (%GC) – (675/N), where %GC is the percentage of GC
5′-TTGAAAATATTTCCCATTGCC-3′
compute the annealing temperature for PCR. What is the relationship between Tm (°C) and %GC? Why? (Note: In reality, this computation provides only a starting point for empirical determination of the most useful annealing temperature.)
Want to see the full answer?
Check out a sample textbook solutionChapter 20 Solutions
Concepts of Genetics (12th Edition)
- You extract DNA from 200, You pipette 200 microlitres of this extraction sample into a 3-ml cuvette and make up to 3.0 ml using buffer. The absorbance at 260 nm (A260) of the solution in the cuvette is 0.2 (Remember: an A 260 of 1.0 corresponds to a DNA concentration in the cuvette solution of 50 micrograms per ml). Calculate the total amount of DNA in 100g wheat germ, assuming that the extraction efficiency of DNA from wheat germ during your lab protocol is 40%. Please fill out each of the boxes in the Table below What to Calculate Calculation / Result Marks (x / 100) 12/100 DNA concentration in cuvette solution (in microgram per ml) Dilution factor of DNA sample in cuvette 12/100 12/100 Total amount (microgram) of DNA in the entire extraction sample Total amount (milligram) of DNA in 100g wheat germ 24/100 assuming an extraction efficiency of 40%arrow_forwardA facility says they need 15 μL of a 40 ng/μL solution of plasmid DNA for sequencing. The typical yield for a DNA miniprep 5 μg eluted in 50 μL of solution. What do you need to do (for example dilution) to send the appropriate amount to the facility? Show all math work with an explanation.arrow_forwardWhat is the concentration of a DNA solution that absorbs 0.812 and 0.463 at 260 and 280 nm, respectively? Is the DNA solution considered to be good quality? Why or why not?arrow_forward
- If the length of E.coli DNA is 1.36 mm, calculate the number of base pairs it containsarrow_forwardYou have a very concentrated sample of DNA which you need to dilute for sequencing 1:6000 with a final volume of 10 μl. How would you do this in four steps, using a serial dilution? Do not pipet less than 1 ul and do not make more than 10 ul per dilution. Describe how to do each dilution using the format suggested below.arrow_forwardWhy is sodium acetate used in DNA precipitation by ethanol, rather than sodium chloride? (Hint – acetate is an organic ion. Chloride is not.)arrow_forward
- The Tm of a DNA strand can be calculated by hand using the formula: (2 ℃)(?????? ?? ? + ?) + (4 ℃)(?????? ?? ? + ?) = ??℃ Using this formular, calculate the Tm for the following DNA sequence: [CTTTCACAGCCACTATCCAGCGGTAC] Note: This formula has several limitations and is not useful for sequences longer than 14 bp. Use the Internet search to find an online Tm calculator. Use this calculator to find the Tm of the above sequence. Using information from your search, identify three factors that can affect the Tm.arrow_forwardOne gram of cultured human cells contains about 10^9 cells and occupies roughly 1 mL. if the average molecular mass of a base is 660 daltons and each cell contains 6,4 *10^9 bp, what mass of DNA is present in this one-gram sample? If all the DNA molecules in the sample were laid end to end to form a single thread. Would it be long enough to reach from the Earth to the Moon (385.000 kilometers).arrow_forwardTo carry out sequencing, you need to include 600 ng of DNA and a total of 6.4 pmol of sequencing primer. If your concentration of DNA (determined by A260 reading on a Nanodrop Spectrophotometer) is 89.0 ng/μL, how many μL of this sample do you need for a total of 600 ng?arrow_forward
- 1). What is the concentration of a solution of DNA with an OD260 of 0.3? ----I got 15 micrograms/mL (50 x 0.3) 2). How many microliters of this solution of DNA would you need if you wanted 1.5 micrograms?arrow_forwardAssuming the average weight of a deoxynucleotide monophosphate (dNMP) is 327.0 g/mol, how many picomoles of DNA are present in 500ng of a 1000bp DNA fragment?arrow_forwardA typical bacterial DNA has a molar mass of 4 × 109 g m ol-1 . Approximately how many nucleotides does itcontain?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education