Prepare a concept map on the large and diverse family of Enterobacteriaceae. The following are some of the concepts you may connect with a proposition: — general and unique characteristics; — clinical manifestations; — mode of transmission; — virulence factors; — biochemical test results (e.g. oxidase positive)
Q: Which of the following are characteristics of all coliforms? Select all that apply.…
A: Coliform bacteria are defined as either motile or non-motile.
Q: Which of the following is taken up by M cells of the large intestine, escapes out the bottom of the…
A: Shigella: A bacillary dysentery, a disease provoking severe bloody and mucous diarrhea…
Q: This is the genus of the smallest intercellular helminth parasite: The Anopheles genus of mosquito…
A: Parasite A parasite is an organism that lives on or in a host organism and gets its food from or at…
Q: From figure. Which of the thioglycollate tubes in thefigure would be indicative of Bacillus and…
A: Introduction Thioglycolate broth is the medium which is used to test the aerotolerance of the…
Q: Which of the following bacteria is associated with gastric and duodenal ulcers? Select one: a.…
A: Ulcers originates when the acid present in stomach start damaging the digestive tract lining.…
Q: Recall the medically important members of the Enterobacteriaceaeand the characteristics they have in…
A: Enterobacteriaceae is a large family of Gram-negative bacteria. Majority of their members inhabit…
Q: What are all the different types of infections the following antibiotic resistant microbes…
A: Antibiotic resistance in bacteria occurs when germs like bacteria develop the ability to defeat the…
Q: Terma: Wolbachia, L1, L2, L3, L4, aduit, proboscis, fat body, hemocoel, midgut, hemocyte, melanize,…
A: Heartworm disease is a serious ailment that results in intense lung ailment, coronary heart failure,…
Q: Pseudomonas is a gram-negative rod-shaped bacterium, sometimes inhabits the intestinal tract, and…
A: Gram negative bacteria are those bacteria which does not retain the crystal violet stain used in the…
Q: List and describe at least three medically important members of family Enterobacteriaceae. What…
A: Bacteria are microscopic single-celled organisms that thrive in diverse environmental conditions.…
Q: The most common preferred portal(s) of entry for human pathogens is (are): 1. Mucous membranes…
A: The infectious agents enters the body through the various of the portals including the skin ,…
Q: Illustrate and describe the following life cycle: (Please include references) a. Ascaris…
A: Introduction Ascaris lumbricoides:- Ascaris lumbricoides is an intestinal roundworm that causes…
Q: Which of the following is not a characteristic of the Enterobacteriaceae? Group of answer choices…
A: Enterobacterium is a family of gram negative bacterium, facultative anaerobe, non spore forming…
Q: Which of the following is not an opportunistic enteric bacterium?a. Serratia b. Klebsiella c.…
A: Shigella infection (shigellosis) is also known as intestinal disease which is caused by a family of…
Q: Mutant strains of Helicobacter pylori that lack the ability to produce urease fail to cause…
A: Peptic ulcer disease (PUD) could be a lesion of the membrane layer within the stomach or duodenum…
Q: Select all statements that are true regarding members of the genus Mycobacterium. O They contain…
A: Introduction: TB or tuberculosis is a disease caused by a bacterium called Mycobacterium…
Q: Paragraph Styles Organisms Habitat Virulence Pathology Other ram (+) Bacilli - Sporeforming C.…
A: Bacteria is the organism which are found almost everywhere. They are small and single celled…
Q: Give the following details of the phyla Proteobacteria (-Alpha, Beta-, Delta-, Epsilon)…
A: In 1987, the American microbiologist Carl Woese , suggested that a diverse and a large group of…
Q: Helicobacter pylori is able to use urease to neutralize the stomach environment because the enzyme…
A: These are microbial urease found in stomach. As ureases they catalyze urea to produce ammonia and…
Q: Why is it important medically to distinguish between the enterococci andthe non-enterococci?
A: Enterococci and non-enterococci are the terms used to indicate bacterial cells that are in cocci…
Q: Describe how Balantidium coli invades the tissue. How is it different from invasion by Entamoeba…
A: Parasitic infections are found all around the globe and various diagnostic techniques have been…
Q: rum 2. Metallosphaera sedula 3. Lactobacillus acidophilus
A: Metabolism is a term that refers to all chemical events that take place in order for cells and…
Q: List the scientific names of 2 microbes harbouring in the human intestine.
A: Intestines are the crucial organs in the gastrointestinal tract of human beings. Their main role is…
Q: Match the description listed below to the correct bacterium. Grows in intestine of ruminants like…
A: The bacteria are unicellular prokaryotic organisms. The disease causing strains of bacteria are…
Q: Explain how the following diseases differ and how they are similar: giardiasis, amoebic dysentery,…
A: Parasites are microorganisms that include protozoans and worms that infect humans and animals and…
Q: What are the implications if your drinking water is contaminated with coliforms? And give three…
A: Public water systems are required to deliver safe and dependable consuming water to their clients 24…
Q: Resistance to antimicrobial agents is more commonly seen in hospital-acquired infections with…
A: Bacteria acquire drug resistance and spread within their population. Drug resistance in bacteria…
Q: list bacterias that are part of the Enterobacteriaceae family
A: Enterobacteriaceae is a family of gram-native bacteria under Phylum Proteobacteria.…
Q: E.coli is part of the normal microbiota of the intestines and can cause gastroenteritis. Explain why…
A: E.coli is a bacteria naturally present in human gut in lower segment of large intestine. E.coli can…
Q: Please draw a figure of Planaria (Dugesia) (class Turbellaria) and label the drawing with the terms…
A: Answer -
Q: Listeria monocytogenes-how listeriosis disease occurs and how the food-borne Listeria monocytogenes…
A: Listeria monocytogenes It is a Gram -positive rod shaped bacterium and is able to grow at…
Q: What is sewage? What is the key difference between primary and secondary sewage treatment?
A: The substance that is essential for all life on, in, and above the Earth is seen to be water. It is…
Q: Write a brief description of morphology of the salmonella typhi cell, the genus and species of…
A: Typhoid fever is more common in non-industrial countries. Travelers to Asia, Africa, Eastern Europe…
Q: Which of the following is true about proteobacteria? Select all that apply. O they are gram negative…
A: Proteobacteria The proteobacteria are a major group(phylum) of bacteria. It includes a wide variety…
Q: Bacteria that are obligate intracellular pathogens of humans are considered to be Autotrophs…
A: 1. Bacteria that are obligate intracellular pathogens of humans are considered to be…
Q: Give the genus and species of five bacteria in the family Enterobacteriaceae .
A: In the hierarchy of biological organisation, genus is the one which comes above species and below…
Q: Name the key characteristics shared by the medically importantmembers of the Family…
A: As the name indicates, enterobacteriaceae includes a family of bacteria, which inhabits the…
Q: The incubation period for salmonellosis (enteritis) is longer than for staphylococcal food poisoning…
A: Incubation period: It is the number of days between when you're infected with something and when…
Q: Relate the life cycle, pathogenesis, and control of Entamoeba histolyticato that of Balantidium…
A: A parasite is a life form that lives on or in a host living being and gets its food from its host.…
Q: Describe Hyalohyphomycosis, its symptoms, life cycle and control
A: Hyalohyphomycosis is a fungal infection caused by moulds with hyaline, light-colored, branched or…
Q: Outline the reaction by which some clostridia ferment amino acids, and relate this carbon substrate…
A: The fermentation of amino acids through the Stickland reaction is a remarkable metabolic feature of…
Q: Enzyme composition of succus entericus is best represented by : 1.Trypsinogen, Nuclease, Maltase…
A: Succus entericus is the intestinal juice that is secreted in small quantities in the small…
Q: Every year, supposedly safe municipal water supplies causeoutbreaks of enteric illness.a. How in the…
A: Water pathogens enter the water sources by faecal contamination. When the infected person or animal…
Q: The large intestine contains bacteria, such as E.coli, that synthesize vitamin K and some B vitamins…
A: The bacteria Escherichia coli can be beings in the environment, foods, and the intestines of humans…
Q: Write a brief description of Escherichia coli, Yersinia Pestis, Yersinia enterocolitica
A: All the bacteria belonging to different families and having different characteristics. Their shapes…
Q: Which of the following is NOT an obligate intracellular organism? O Chlamydia trachomatis O All of…
A: They are a class of organisms that reproduce strictly inside the host organism. They include…
Prepare a concept map on the large and diverse family of Enterobacteriaceae. The following are some of the concepts you may connect with a proposition:
— general and unique characteristics;
— clinical manifestations;
— mode of transmission;
— virulence factors;
— biochemical test results (e.g. oxidase positive)
Step by step
Solved in 2 steps with 1 images
- Some bacteria, protozoa, and viruses that cause foodborne illness are: E.coli, Salmonella Norovirus Staphylococcus aureus Clostridium botulinum Campylobacter Clostridium perfringens Hepatitis A. Giardia (mainly water) Listeriosis Select two (2) of the foodborne illnesses listed above and report the following information for each. Disease name and whether it is a bacteria, protozoa, or virus Type of contamination (infection or intoxication) Infectious pathway Possible sources and foods affected Symptoms Incubation period Treatment Current Statistics, how many affected, where, when etc.Give the following details of the phyla Proteobacteria (-Alpha, Beta-, Delta-, Epsilon) General charcteristic & Unique characteristic Metabolic diversity Key Genera MorphologyWhich of the following is true about proteobacteria? Select all that apply. O they are gram negative O they are gram positive O they are typically classified based on their G+C content O Agrobacterium is an example of a proteobacterium O They are all pathogenic O None are pathogenic O Some genera are important members of the nitrogen cycle O They are metabolically diverse Most are extremophiles O Neisseria is an example of a proteobacterium
- Select all statements that are true regarding members of the genus Mycobacterium. O They contain mycolic acids O They can cause tuberculosis O One species causes tuberculosis O They are proteobactria O They are practically impenetrable by antibiotics O Their cell walls lack peptidoglycan O They are easy and fast to grow under laboratory conditionsCharacterize and identify the Genus of the following cyanobacterium Genus Identification of Cyanobacterium C (see image) Table: Descriptive Characteristics for Genus Identification of the Cyanobacterium C. Morpho-cytological Characteristics Characters 1. Vegetative cell shape (2D) 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. Vegetative cellular arrangement (grouping) Number of cells in large aggregates (colonies) Layers of trichomes in a filament Presence and shape of a heterocyst in the trichome Presence and shape of akinetes in the trichome Presence of baecytes (endospores) in a colony Polarity and tapering of the trichome Shape of end cells in a filament Presence of a gelatinous or colonial sheath Presence of branching Protoplasm color Protoplasm granulation Thylakoid arrangement if observable (ultrastructural) Diagnostic Key Characteristics for Genus ID using the dichotomous key of Lobban & N'Yeurt (2006) Latest Classification based on Algaebase (algaebase.org) Kingdom:…You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGT
- Here are four toxins: diphtheria toxin, cholera toxin, tetanus toxin, and exfoliative toxin. Choose two of them and answer the following questions: 1. Is it an exotoxin or an endotoxin? 2. Which bacterial species produces it? 3. Briefly describe its mode of action and how it causes damage to the host cells. Include specific signs and symptoms.Answer all of the following true or false questions: True / False: Choose the answer that best fits each statement. The presence of Escherichia coli in water is used as an indication of fecal contamination. The Vibrio species are characterized as being curved, gram negative bacteria with polar flagella. Chlamydia, Rickettsia and Mycoplasma are all obligate intracellular parasites. Neisseria, Staphylococcus, and Streptococcus are all gram-positive cocci. Tetanus, botulism, and diphtheria are diseases caused by gram positive, soil-dwelling, spore- forming rods. Most togaviruses are transmitted to humans via insect bites. The reason why dogs do not get measles is because their cells lack the correct receptor sites for that virus. Glycoprotein spikes are found on the capsids of viruses. A naked virus lacks a capsid. The polioviruses and hepatitis A virus are transmitted by contaminated food or water. Staphylococcus grows best in a high salt environment.…Fill out the data table attached below with regard to the medically significant bacteria. Attached beside is a sample data table for Staphylococcus aureus. Microorganism/Causative Agent: Candida albicans *for the discovery, who discovered it? when was it discovered and how?
- (b) How the “milk borne diseases” are spread? Enlist all the “Four Sources” from which the “microorganism in milk” come from. Enlist the “Diseases” transmitted through “Milk” like the “diseases of bovine (esp. Ox and Cow) origin. Enlist the “Diseases” transmitted through “Milk” like the “diseases of human” origin. Define and briefly discuss the “pasteurization of milk”.Identify the genus that best fits each of the following descriptions: a. This organism can produce a fuel used for home heating and for generating electricity. b. This gram-positive genus presents the greatest source of bacterial damage to the beekeeping industry. c. This gram-positive rod is used in dairy fermentations. d. This gammaproteobacterial genus is well suited to degrade hydrocarbons in an oil spill.In 2005, J. Robin Warren and Barry J. Marshall shared theNobel Prize in Medicine for discovering the bacteriumHelicobacter pylori and for establishing experimental proofthat it plays a major role in gastritis and peptic ulcer disease.The story began when Warren, a pathologist, noticed thatbacilli were associated with the tissues taken from patientssuffering from ulcers. Look up the history of this case and describeWarren’s first hypothesis. What sorts of evidence did ittake to create a credible theory based on it?