a QUESTION 7 Please read the paragraph regarding transcription termination and fill in the blanks with words from the word bank below (not all of the words will be used): Rat1 ATP Adenosine AAUAAA Rho TATA A-site RNA polymerase Uracil Rut site Guanosine Hairpin There are two known mechanisms of transcription termination in prokaryotes. One mechanism requires a protein complex called This protein complex binds to the which is located on the RNA that is being transcribed. This protein complex then moves toward the stalled RNA polymerase complex and unwinds the RNA from the DNA. A second mechanism for termination in prokaryotes requires an RNA termination sequence that contains a secondary structure called a followed by a string of nucleotides. Transcription termination for RNA Polymerase II in eukaryotes happens when the termination consensus sequence, is transcribed leading to cleavage of the mRNA 11-30 nucleotides downstream of the termination sequence. Once cleavage occurs, binds to the 5' end of the mRNA that is still attached to the RNA polymerase/DNA complex and degrades the remaining mRNA. This leads to the dissociation of the RNA polymerase from the DNA.

a QUESTION 7 Please read the paragraph regarding transcription termination and fill in the blanks with words from the word bank below (not all of the words will be used): Rat1 ATP Adenosine AAUAAA Rho TATA A-site RNA polymerase Uracil Rut site Guanosine Hairpin There are two known mechanisms of transcription termination in prokaryotes. One mechanism requires a protein complex called This protein complex binds to the which is located on the RNA that is being transcribed. This protein complex then moves toward the stalled RNA polymerase complex and unwinds the RNA from the DNA. A second mechanism for termination in prokaryotes requires an RNA termination sequence that contains a secondary structure called a followed by a string of nucleotides. Transcription termination for RNA Polymerase II in eukaryotes happens when the termination consensus sequence, is transcribed leading to cleavage of the mRNA 11-30 nucleotides downstream of the termination sequence. Once cleavage occurs, binds to the 5' end of the mRNA that is still attached to the RNA polymerase/DNA complex and degrades the remaining mRNA. This leads to the dissociation of the RNA polymerase from the DNA.

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.
Transcription factors function in the nucleus. However, like (almost) all eukaryotic proteins,they are translated in the cytosol. Can you draw a visual to explain how transcription factor proteinsenter the nucleus from the cytoplasm? Can you also include a representation of relevant proteins and proteindomains to explain how these proteins reach their destination. Thank you
Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription? Group of answer choices 1.Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds. 2.Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds. 3.Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination. 4.Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination.
46What is the A-site of the ribosome? A.exit siteb.aminoacyl-tRNA binding sitec.peptidyl-tRNA binding siteD.peptidyltransferase site 47This sequence motif, which is called the ( ) , is usually located 25 to 30 bp upstream from the transcription initiation site. 48Pre-mRNA requires specific sequences for precise __________ to occur. A.splicingb.taggingc.replicationD.skipping
The diagram below shows an imaginary eukaryotic structural gene containing two exons. The exon nucleotides are numbered beginning at the transcription start site and a portion of the intron is not shown to save space: Help Center? transcription start site promoter U STACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT...TCAGGTACT U UUU} Phe UUG} Leu exon 1 3 ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA...AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT... Second letter C Predict the amino acid sequence of the polypeptide encoded by this structural gene. The genetic code is provided below.
67RNA interference was first discovered in Drosophila melanogaster. Yesorno 68Which of the following is required for the bacterial ribosome complex to disassemble?A.EF1A-GTPb.Signal sequencec.Release factorD.EF1B 69A transcription unit must have an initiation signal called a _____________ for accurate and efficient transcription to take place. A.transcription start siteb.promoterc.transcription initiation factorD.ori
Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?
The human α-tropomyosin gene is alternativelyspliced to produce different forms of α-tropomyosinmRNA in different cell types (Figure Q6–3). For all forms ofthe mRNA, the protein sequences encoded by exon 1 arethe same, as are the protein sequences encoded by exon10. Exons 2 and 3 are alternative exons used in differentmRNAs, as are exons 7 and 8. Which of the following state-ments about exons 2 and 3 is the most accurate? Is thatstatement also the most accurate one for exons 7 and 8?Explain your answers.A. Exons 2 and 3 must have the same number ofnucleotides.B. Exons 2 and 3 must each contain an integral num-ber of codons (that is, the number of nucleotides dividedby 3 must be an integer).C. Exons 2 and 3 must each contain a number ofnucleotides that when divided by 3 leaves the sameremainder (that is, 0, 1, or 2).
Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription? Group of answer choices Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination. Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds. Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination. Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds.
Consult the DNA below. Only one strand is shown (the complementary strand is not shown). What 2 aspects can you observe in this animal DNA that indicates that it is the regulatory part of a eukaryotic transcription unit? (The spaces are added to make the sequence easier to read). AGAGGGCGGT CCGTATCGGC CAATCTGCTC ACAGGGCGGA TTCACACGTT GTTATATAAA TGACTGGGCG TACCCCAGGG TTCGAGTATT CTATCGTATG GTGCACCTGA CT..................
Which statements are true? Explain why or why not.1 The consequences of errors in transcription areless severe than those of errors in DNA replication.2 Since introns are largely genetic “junk,” they do nothave to be removed precisely from the primary transcriptduring RNA splicing.3 Wobble pairing occurs between the first positionin the codon and the third position in the anticodon.4 During protein synthesis, the thermodynamics ofbase-pairing between tRNAs and mRNAs sets the upperlimit for the accuracy with which protein molecules aremade.5 Protein enzymes are thought to greatly outnum-ber ribozymes in modern cells because they can catalyzea much greater variety of reactions and all of them havefaster rates than any ribozyme.
34The crystal structure has been determined for the complete 12-subunit yeast RNA polymerase II bound to a transcription bubble and product RNA. Yesorno 35 ( ) can be used to purify transcription activator proteins 36A mutation that adds or deletes a base pair in the open reading frame and is termed a ( ) mutation.