Transcription factors function in the nucleus. However, like (almost) all eukaryotic proteins, they are translated in the cytosol. Can you draw a visual to explain how transcription factor proteins enter the nucleus from the cytoplasm? Can you also include a representation of relevant proteins and protein domains to explain how these proteins reach their destination.

Transcription factors function in the nucleus. However, like (almost) all eukaryotic proteins, they are translated in the cytosol. Can you draw a visual to explain how transcription factor proteins enter the nucleus from the cytoplasm? Can you also include a representation of relevant proteins and protein domains to explain how these proteins reach their destination.

Name: Transcription factors function in the nucleus. However, like (almost)
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Transcription factors function in the nucleus. However, like (almost) all eukaryotic proteins,they are translated in the cytosol. Can you draw a visual to explain how transcription factor proteinsenter the nucleus from the cytoplasm? Can you also inc

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 13QP

See similar textbooks

Similar questions

What effect would inhibitors of histone deacetylases have upon transcription? Group of answer choices They would increase transcription by making the chromatin more compact They would increase transcription by making the chromatin less compact They would decrease transcription by making the chromatin more compact They would decrease transcription by making the chromatin less compact For this question, we will consider a eukaryotic mRNA that has four exons (E1, E2, E3, E4) and three introns (I1, I2, I3). What could occur if a protein were to bind over the 3' splice site of intron 2 (I2)? Group of answer choices The processed mRNA would consist of: E1+E2+E3+E4 The processed mRNA would consist only of: E1+E3 The processed mRNA would consist only of: E3+E4 The processed mRNA would consist of: E1+E2+E4
Ignoring transcriptional methods, name two other "levels" aka methods a cell can use to ultimately control gene expression. Remember you are going to avoid mentioning things that affect transcription levels.
Briefly discuss (referring to the images provided) why mutant 2 fails to produce functional protein. Note that none of the mRNA transcribed from this gene is of the expected size; some of the mRNA molecules produced are 223 nucleotides shorter than expected, whilst others are 47 nucleotides longer than expected.
The interphase nucleus is a highly structured organelle with chromosome territories, interchromatin compartments, and transcription factories. In cultured human cells, researchers have identified approximately 8000 transcription factories per cell, each containing an average of eight tightly associated RNAP II molecules actively transcribing RNA. If each RNAP II molecule is transcribing a different gene, how might such a transcription factory appear? Provide a simple diagram that shows eight different genes being transcribed in a transcription factory and include the promoters, structural genes, and nascent transcripts in your presentation.
The diagram below depicts an active transcription bubble after a short period of RNA synthesis during the transcription process of a prokaryotic gene. Redraw the diagram and label parts (i) to (v) on the diagram. Motivate your answers. (i) the template and the non-template strands; (ii) the orientation (direction) of both DNA strands and that of the newly synthesised RNA strand; (iii) the location of a possible promotor sequence; (iv) the location of a possible Shine-Dalgarno sequence; (v) the specific area of activity of a RNA polymerase.
In a written paragraph, describe the difference between prokaryotic and eukaryotic TRANSCRIPTION. In your response, include the following: - differences in what structures (DNA, RNA, proteins etc...) are involved - differences in timing and location - DO NOT include any details on what happens after transcription
The following double-stranded DNA sequence is part of a hypothetical yeast genome which contains a very small gene. Transcription starts at the Transcription Start Site (TSS), proceeds in the direction of the arrow and stops at the end of the Transcription Terminator (green box). 5' 3' TSS CTATAAAAATGCCATGCATTATCTAGATAGTAGGCTCTGAGAAATTTATCTCACT | | | | | | | | | | GATATTTTTACGGTACGTAATAGATCTATCATCCGAGACTCTTTAAATAGAGTGA - 5' PROMOTER TERMINATOR 3' a) Which strand (top or bottom) is the template strand? Explain why. b) What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends. c) What is the sequence of the protein produced from the mRNA? d) If a mutation (an insertion) were found where a T/A (top/bottom) base pair were added immediately after the T/A base pair shown in red, what would be the sequence of the mRNA? What would be the sequence of the protein?
In eukaryotic cells, secreted proteins are initially directed to the endoplasmic reticulum and then via the Golgi, where they are released into the extracellular environment through secretory vesicles. A more easier way would be for secretory protein-producing ribosomes to be localised to a translocon in the plasma membrane, with the protein being secreted directly during translation. Consider three possible benefits of the more roundabout method for protein secretion versus the simpler, more straightforward approach indicated.
You are working on a protein for a research project. The protein does not express well in prokaryotic expression systems so you decide to try a eukaryotic system, baker’s yeast, instead. As part of the expression system, you add a signal peptide to the protein so that it will be exported through the endomembrane system to the outside of the yeast cell. This makes purifying the protein much simpler. During the purification, you notice that the protein is heavier than it should be during gel filtration chromatography. This is confirmed by SDS-PAGE. What could be the reason that the protein has gained mass when expressed in the eukaryotic system?
Genetic expression involves transcription and translation. Match the structure or molecule to the step site where amino acid combines with tRNA intron sequences are removed and exons are combined together makes RNA more stable in the cytoplasm region of DNA with sequences that combine with RNA polymerase transcribed strand that will go on to translation connects amino acid to polypeptide chain and leaves tRNA site where tRNA with amino acid enters the ribosome recognized by the protein synthesis machinery enzyme that connects RNA nucleotides to DNA template part of tRNA with nucleotides complementary to mRNA 1. peptide bond 2. 3. antisense strand 4. anticodon loop 5. RNA polymerase 5' cap 6. A site 8. 7. splicing 9. promoter region acceptor stem 10. poly-A tail
Name: Clas: Date: Transcription 3" ATGACGGATCAGCCGCAAGOCGGAAfTGGCGACATAA UACUGCCUAGUCGGCGUU 3 5' WA WAW TACTGCCTAGTCGGCG TCGCCTTAACCGCTGTATT 3' 6 Label the diagram as you read the following passage. Transcription is the process cells use to copy information from DNA into messenger RNA copies. Part of the chromosome's tightly wound-up long strand of DNA is "loosened" to allow for RNA polymerase room to copy part of the DNA. Think of this as opening a page out of a giant book with thousands of pages to make a copy of just that one page. One side of the DNA strand is the template strand (or anti-sense strand) and is used by an enzyme called RNA Polymerase to create the messenger RNA. RNA Polymerase is directed by a bunch of proteins called transcription factors to the spot it needs to start copying. RNA Polymerase reads the template strand from the 3' end to the 5' end and creates a messenger RNA strand that is complementary to the template strand. In the diagram above, you can see that…
Many transcription factors function as dimers. The binding sites of dimeric transcription factors have a common feature that allows the dimer to bind. Write out an imaginary sequence that shows this feature (make it double stranded)."