FA23 week 3 Problem Set

Question:- 1. Transcribe and translate the given region of DNA, note that the promoter region is to the right of the sequence, and translation must start from the start codon. Include 3' and 5' for RNA transcript and N- and C- terminus in your final peptide sequence. Use the 1-letter form of amino acids when writing the sequence of polypeptide   5' CCCCAGCGTAAGTTTATGGTTACTCATGAA 3' 3' GGGGTCGCATTCAAATACCAATGAGTACTT 5'

Complete the following problems.  1. Draw a molecule of phosphatidyl serine using palmitic acid and linoleic (Δ9,12) acid 2. Consider the following coding strand sequence of DNA to a corresponding amino acid sequence. This represents the first amino acids to be translated. Underline the codon where translation will be initiated, and give the amino acid sequence of the peptide produced.                5’-CGATGCTCAAGTTTC-3’ 3. Within the matrix of the mitochondria, the pH is approximately 6.8 ([H+] = 1.6 X 10-7), while it is 7.4 ([H+] = 4.0 X 10-8) in the intermembrane space outside the matrix. Calculate the free energy driving transport of hydrogen ions from the intermembrane space to the matrix. Remember to include both the concentration and the membrane potential factors. 4. Draw the adenosine-5’-diphosphate.

1_30*_SP23 - General Biology I (for majors)/1 of us page The anticodon sequence created from the following DNA: TACGGGGCTGAGATT F1 Select one: O a. Tyr-Gly-Ala-Glu-lle O b. AUGCCCCGACUCUAA c. UACGGGGCUGAGAUU O d. Met-Pro-Arg-Leu-STOP F2 # 80 F3 $ 000 000 F4 % F5 MacBook Air F6 & r F7 DII F8

GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…

Tn Midterm test Fall 2020 (page 2 of x A elearn.squ.edu.om/mod/quiz/attempt.php?attempt3D1335328&cmid%3D6971498page=1 SQU E-leaning System (Academic) Question 21 The direction of mRNA molecule synthesis is .: Not yet answered Select one: Marked out of O a. From DNA strand that starts with 5' 1.00 O b. In the direction of 3' to 5 P Flag question O c. From DNA strand that starts with 3' O d. From RNA strand that starts with 3' O e. From RNA strand that starts with 5' Question 22 Which of the following organelles do plants and animals have in common? Not yet answered Select one: Marked out of O a. mitochondria, ribosome, nucleus, cell membrane, cytoplasm 1.00 O b. mitochondria, vacuole, nucleus, cell membrane, cell wall F Flag question O c. mitochondria, vacuole, nucleus, cell membrane, centrioles O d. mitochondria, vacuole, nucleus, cell membrane, cell wall, chloroplasts O e. mitochondria, vacuole, nucleus, cytoplasm, cell wall, lysosome

Question 1 options: The specificity pocket of the serine protease chymotrypsin, which interacts with Tyr and Phe-containing peptide sequences, contains a Ser residue. A research group is trying to modify chymotrypsin such that it has a low KM with Trp-containing peptides. Enter the name or abbreviation of an amino acid that the Ser could be mutated to that would likely have the desired effect.  (Hint: look at the diagrams of the specificity pockets shown in the course slides, and consider how the Ser would need to change to account for the difference between Tyr/Phe and Trp.)

Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC   1. Identify the gene from which the querysequence originates (Name of gene) 2. Provide the FULLprotein sequence encoded by the gene. 3. Are different splice variants known for this gene? 4. What human disease has been connected to this gene? 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.

15-2. Explain whether the following statements are true or false.Justify the false ones.A. Ribosomes are the cytoplasmic structures that duringProtein synthesis is linked by an mRNA moleculeforming polyribosomes.B. The Leu-His-Arg-Leu-Asp-Ala-Gln-Ser- Amino Acid SequenceLys-Leu-Ser-Ser is a signal sequence that directs proteinsinto the endoplasmic reticulum.C. All transport vesicles in the cell must have av-SNARE protein in its membrane.D. The transport vesicles carry protein and lipid to thecell surface.E. If the delivery or distribution of lysosomal proteinsprospects from the trans-Glogii network to endosomes areblock, lysosomal proteins would be secreted by pathwaysof constitutive secretion like those in Figure 15-28.F. Lysosomes digest only substances that have been takenby cells by endocytosis. 15.3 Many of the proteins produced in the reticulumendoplasmic changes such as the addition ofcarbohydrates (oligosaccharides). What is the function of thesesugars in such proteins? 15.4…

Question:- a.Explain the production of chymosin in a prokaryotic vector and the problems encountered in its production. b. What is chymosin used for and why the need for cloning the gene?

Adec ct L AA AAe mo LAe AaB A Exercises: Directions: Complete the following lines for frame shift mutations. Write each codon on the line provided and below it identify the specific amino acids the codon coded for. DNA Sequence: ATG ATA GAA CCG GGT TAC CAT CGT GAT AGA 1. Insertion: ATG ATA Insert a nitrogen base 2 Deletion: ATG ATA GAA Delete a nimogen base REVISED KNOWLEDGE: Actual answers to the process questions/ focus questions I 1. Why is the base pairing in DNA important? Complementay base pairing is important in DNA as it allows the base pairs to be arranged

Third letter UCAG UCAGH CAC First letter Part 5: Coding Practice 1. Use this sequence of DNA to answer the following former test questions: 5'-- TTAATGGGACAGCTTGTGTAGAGG --3' a. What is the complementary strand of DNA? b. Using the complementary strand of DNA (your answer from part a) as the template strand, what is the transcribed mRNA sequence? C. What is the amino acid sequence translated from the strand of mRNA synthesized in part b (use the genetic code below)? Remember: i. Start codon! ii. Stop codon! bac ocent Seond letter UUU Phe UAU Tyr UGU UGC Cys UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp G C. UUA UCA UUG Le UCG [ CAU ] CAC CUU CGU His CUC C CGC ne. CCA Arg Pro CUA CAA CGA CCG CAG Gin CGG CUG AAU 1 AAC Asn ACU AGU [ [ AUU AUC Ile AGC Ser Thr A AUA AGA AGG ACA AAA Arg AUG Met ACG AAG GUU GCU GAU GGU Asp GAC GCC GGC GUC Val G GUA GCA Ala GAA GGA Gly GAG Glu GGG GUG GCG

31_30*_SP23 - General Biology I (for m 24 ed out of nove flag evious page A $ Transcribe the following DNA: TACGGGGCTGAGATT Select one: O a. UACGGGGCUGAGAUU O b. Tyr-Gly-Ala-Glu-lle C. Met-Pro-Arg-Leu-STOP O d. AUGCCCCGACUCUAA MacBook Air

08 Nucleoside and nucleotide analogs are two closely related classes of anti-viral drugs that inhibit viral DNA or RNA polymerase enzymes. What is their most common mechanism of action and why are they often referred to as "chain terminators"? Edit View Insert Format Tools Table A xd0 Paragraph v They are referred as chain terminators because the sturcutre when looked at does not contain a 3 prime end 31 8 8:10 EE O 6 n

Procedure: Refer to the Genetic Code Table below to identify the right amino acid coded. To determine the order of bases in the first column (uNA), second column (codon) and the third column is the anticodon. Consider the complementary base pair in DNA and in RNA To identify the amino acid, took at the bases in the MRNA codon, example AUG using the Genetic Code Table. Lool: for the first letter of the MRNA codon on the left side of the genstic code table (A), the second letter of the MRNA on the second letter column (U), and the third letter on the right-side column (G). AUG codes for the amino acid -methionine, Do the same with the other codons in the chart. Genetic Code Table 2nd posttion of codon UUU Phe Phenylalanine UCU Ser S Serine Phenylalanine UC C Ser S Serine UCA Ser S Serine UCe Ser S Serine CCU Pra P Proline UAU Tyr Y Tyrosine UAC Tyr Y Tyrosine UGU Cys C ysteine UGC Cys C Cysteine UUC Phe F UUA Lau UUG Leu CUU Leu CUC CUA Leucine UGA UGG Trp W Tryptophan G stop stop L…

Hi all, If I could have questions 4-10 answered that would be perfect. GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the…

8:52 Protein 1-10092015113603.pdf https:api.schoology.comv1attachment169963839... Name Class Date Section Protein Synthesis pages 148-153) 7-3 SECTION REVIEW In this section you studied the process of pro- tein synthesis. You learned that the informa- tion that DNA transfers to messenger RNA (MRNA) is in the form of a code. When the information is decoded, chains of amino acids, called polypeptides, are formed. Polypeptides During translation, each MRNA codon in turn make up proteins, which direct biochemical pathways and are responsible for cell structure and movement. The genetic code is determined by the arrangement of the nitrogenous bases in DNA and RNA. A code word in DNA consists of a group of three nucleotides. When transcribed into MRNA, each code word, or codon, desig- nates a specific amino acid that is to be placed in the polypeptide chain. More than one codon may code for a particular amíno acid. The MANA sequence AUG serves as an initiator, or "start," codon. Three other…

8:52 Protein 2-10092015113649.pdf https:api.schoology.comv1attachment169963839... Name Class Date Interpreting Diagrams: Understanding the Main Ideas The Genetic Code (MRNA) Lysine Lysine Asparagine Asparagine Arginine Arginine Serine Serine Isoleucine Methionine Isoleucine Isoleucine Threonine Threonine Threonine U Threonine c Glutamic acid Glycine Glutamic acid Glycine Aspartic acid Giycine Aspartic acid Glycine Valine Valine Valine Valine Alanine Alanine Alanine Alanine "Stop" codon "Stop" codon Leucine Trytophan Cysteine Cysteine Al Gl "Stop" codon Tyrosine Тугosine Serine Serine Phenylalanine Serine Phenylalanine Serine Leucine Glutamine Giutamine CHistidine Histidine Arginine Arginine Arginine Arginine Al Leucine Leucine Leucine Loucine Proline Proline Proline Proline Icl A G Second Base in Code Word Use the information in the accompanying figure to complete the following table. The first row has been completed to help you get started. DNA codon MRNA codon IRNA Anticodon Amino…

8:47 ll 5G% 4 Chapter 9 DNA worksheet 2022.d... 2. Write the mRNA transcript from the DNA template in question 1. Remember your enzyme for RNA polymerase must add RNA nucleotides starting with the 5' direction and moving to the 3' direction. So for the MRNA copy the strand of DNA that is 3'-5') 3. Refer to the codon chart at the bottom of the page. Translate the mRNA into a polypeptide using the following rules. (2 points) Direction of translation of mRNA is from 5' to 3'. 1. MRNA codons are read in groups of three nucleotides. 3. Translation must begin at the START codon. 4. the STOP codon terminates translation. 2. THIRD LETTER SECOND LETTER U TulUUU Phe UUC Phe UUA Leu UUG Leu A UGU Cys U JUGC Cys C UCU Ser UAU Tyr UCC Ser UAC Tyr UCA Ser UAA STOP UGA STOPA UCG Ser UAG STOPUGG Tp G CCUU Leu CÚC Leu CỦA Leu CUG Leu AJAUU Ile AUC Ile AUA Ile AUG Met STARTACG ThrAAG Lys GGUU Val GUC Val GUA Val GUG Val CCU Pro CAU His CCC Pro CAC His CCA Pro CAA Gln CCG Pro CAG Gln ACU ThrAAU Asn AGU…

ACTIVITY 7.3.2 1. Name differences between replication and transcription. 2. Write the sequence of the RNA transcribed from the following DNA: 5' GATCAATGCTAG 3' 3' CTAGTTACGATC 5' 152 Copyright 2019. All Rights Reserved.

Please answer only questions 5-10, thank you GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; Journal Name; Volume; Page Numbers) for a recent publication involving the identified gene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebrate homolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL…

1₂ 4.08 H Note: 1.02 2.54 1.02 1.67 E E = EXON H = INTRON Î E 10.8 kbp 3.94 3.66 E = EcoRI site H = Hindill site HI 10.sht E E 1.76 1.10 Fragment sizes are not to scale and all fragment lengths are in kilobase pairs (kbp) Describe how you can determine if the gene is interrupted and, if so, the number of interruptions by restriction endonuclease analysis and Southern analysis. I

8:25 Screenshot_2021120 What I Can Do Activity 6. What is your stand? Directions. Below are some of the arguments about the use of transgenie organism. In your own perspective, explain your answer in not more than 5 sentences. 1. Among the cited examples of GMO, which do you think is the most beneficial? 2. If you are a farmer would you take the chance of growing crops that are pest resistant? Why or why not? 3. Considering the knowledge gained genetic engineering, would you try to patronize GMO fruits and vegetables? Why or why not? 4. Is creating or altering genes of an organism a form of Blasphemy to the creator (God)? Why? 5. Is genetic engineering morally permissible or not?

Question:- 7. Describe how the Polycomb group proteins influence genome expression.

Question. Rewrite the following sentences after correction. (Subject: Biotechnology) The variation in the length of tandem repeat of microsatellite DNA has serious translational affects as this is due to its coding region. Correct: If one parent has sickle cell anemia and other has carrier genotype than there is 25 % chance that any offspring is carrier. Correct: Sickled WBC block the flow of blood and Calcium as they stick together and caused by frame shift mutation. Correct: The N1303K mutation in the CFTR gene of CF patients is autosomal dominant disorder due to insertion of asparagine at 1303. Correct: If a person RBCs have B surface antigen and it will clump with antigen B such clumping indicates Blood type B. Correct: Indirect ELISA can detect polygenic gene expression. Correct:

Which of the following mutational changes wouldyou predict to be the most deleterious to gene function?Explain your answers. 1. Insertion of a single nucleotide near the end of thecoding sequence.2. Removal of a single nucleotide near the beginningof the coding sequence.3. Deletion of three consecutive nucleotides in themiddle of the coding sequence.4. Substitution of one nucleotide for another in themiddle of the coding sequence.

10:14 Protein 5-10092015113503.pdf https:api.schoology.comv1attachment169963838... Name Class Date RNA (pages 146-148) | SECTION REVIEW In this section you were introduced to the molecule that helps put the information in DNA to use: ribonucleic acid, or RNA. ANA Iis a nucleic acid that carries information from DNA to the ribosomes, the organelles in which proteins are made. RNA also carries out the process by which proteins are assem- bled from amino acids. RNA is quite similar to DNA in structure. However, there are some important differ- ences. RNA is single-stranded; DNA is dou- ble-stranded. RNA contains the sugar ribose; DNA contains deoxyribose. And RNA has the nitrogenous base uracil; DNA has thymine. In this section you also learned about the process of transcription. Transcription is t process in which part of a DNA molecule is used as a template for the synthesis of a com- plementary strand of RNA. This process is mediated by an enzyme called RNA poly- merase. The strand of…

Question 4: Explain how a deletion mutation leading to a modification of the 3' untranslated region (UTR) on the CACNA1S mRNA could lead to hypokalemic periodic paralysis without changing the structure of the polypeptide formed? (Note this is not the known cause of hypoKPP, but it makes a good question)

Problem 3: Nitrous acid causes all possible transition mutations, C T and G A. If the normal sequence of a protein contains a valine residue (val) at a particular place, what new amino acid(s) would most often appear in place of the valine residue as a result of nitrous acid mutagenesis? Use a codon chart. O Isoleucine, methionine, alanine O Aspartic acid, glutamic acid, alanine O Only termination codons O Alanine or threonine O Alanine

Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions (with spaces), and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein.    Wild Type DNA Sequence:  3' - CCTCGTTATGTG - 5' Mutated DNA Sequence:    3' - CCTCGTTATTTG - 5'

Problem 4:  You are planning an experiment to use zinc finger nucleases to generate a double-stranded DNA break in a targeted sequence of DNA Name the protein domain in a zinc finger nuclease that is responsible for generating the DNA break Fok1 Name two other genome-engineering proteins that could be used for generating the double-stranded DNA break   What are the advantages and disadvantages of each strategy?

Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein.    Wild Type DNA Sequence:  3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence:    3' - AGTCTCGCCTGT - 5'

Based on standard MS- LS3-1: Fish in a cave system in Mexico is missing its eyes, has thin, translucent skin, and is relatively small (7-10 cm in length). Can you describe by model why structural changes to genes (mutations) on chromosomes may affect proteins and may result in beneficial effects to the structure and function of the fish? Can you answer in the following format? 1- Structure How Structure and Function is Affected by Mutations in Blind Fish Eyes   Scales   Taste Cells   Lateral Line     2- Model to explain what causes these changes: Change: ______________ Adapting an Organism to the Dark Cause: ________________ Stop the Growth of Eyes    Effect: ___________________ Fish with Heightened Other Senses   References: Video: Rare Blind Cave Fish in Mexican Cave System https://www.youtube.com/watch?v=MWdtGuDd8z0   Fact Sheet: Blind Cave Fish https://www.denverzoo.org/animals/blind-cave-fish   Information: Mexican Tetra…

Question:- 1. ATT GAC CAA ATC CAT TGA GAC CAA What chains occur when modified DDTP thymine is added to the DNA sequence above.

20-22. TBX5 is a gene found in vertebrates which is expressed in the heart and forelimbs during development. Parts of the first and last coding exons of the human TBX5 gene are shown below, with start and stop codons in bold: Partial first coding exon: 5' -ACCATGGCCGACGCAGACGAGG-3' Partial last exon: 5' -GTGGAGCGACAATAGCTAAAGT-3' 20. Which primer pair would you use to amplify full length TBX5 coding sequence? a. 5'-ATGGCCGACGCAGACGAGG-3'and 5'-GTGGAGCGACAATAGCTAA-3' b. 5'-ATGGCcCGACGCAGACGAGG-3'and 5'-TTAGCTATTGTCGCTCCAC-3' c. 5'-ATGGCCGACGCAGACGAGG-3'and 5'-AATCGATAACAGCGAGGTG-3' d. 5'-CCTCGTCTGCGTCGGCCAT-3'and 5'-GTGGAGCGACAATAGCTAA-3' e. 5'-GGAGCAGACGCAGCCGGTA-3'and 5'-GTGGAGCGACAATAGCTAA-3' 21. What are the first five amino acids of the human TBX5 protein? Second Letter Phe UCU UCC UCA UCG UGU Cys U UGC UGA Stop A UGG UUU UAU UAC UAA UAG Tyr U UUC UUA UUG Ser a. N-Thr-Met-Ala-Asp-Ala . Stop Stop Leu Trp G CUU C Cuc CUA CUG CU Leu cCC CCA CCG CAU CÁC CAA CAG His CGU CGC CGA b.…

20-22. TBX5 is a gene found in vertebrates which is expressed in the heart and forelimbs during development. Parts of the first and last coding exons of the human TBX5 gene are shown below, with start and stop codons in bold: Partial first coding exon: 5' -ACCATGGCCGACGCAGACGAGG-3' Partial last exon: 5'-GTGGAGCGACAATAGCTAAAGT-3' 20. Which primer pair would you use to amplify full length TBX5 coding sequence? a. 5'-ATGGCCGACGCAGACGAGG-3'and 5'-GTGGAGCGACAATAGCTAA-3' b. 5'-ATGGCCGACGCAGACGAGG-3'and 5'-TTAGCTATTGTCGCTCCAC-3' c. 5'-ATGGCCGACGCAGACGAGG-3'and 5'-AATCGATAACAGCGAGGTG-3' d. 5'-CCTCGTCTGCGTCGGCCAT-3'and 5'-GTGGAGCGACAATAGCTAA-3' e. 5'-GGAGCAGACGCAGCCGGTA-3'and 5'-GTGGAGCGACAATAGCTAA-3'

[ Choose ] [Choose ) in vitro mutagenesis CRISPR-Cas9 system SNP (single nucleotide polymorphism) RNA interference (RNAI) >

Practice Question 2 The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is underlined and bolded. It also contains an origin of replication (ORI) which is found at position 30. 1 20 ORI 40 60 3'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...5' 5'..AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCOCTACGTGATAG...3' promoter A) Assume that replication has been initiated at that ORI. Provide the sequence of the primer that is complementary to the DNA in each of the following positions. Site A - binding to the top strand of the DNA at position 20 – 30 5' 3' Site B - binding to the top strand of the DNA at position 31 – 41 5' 3'