ACTIVITY 7.3.2 1. Name differences between replication and transcription. 2. Write the sequence of the RNA transcribed from the following DNA: 5' GATCAATGCTAG 3' 3' CTAGTTACGATC 5
Q: 71) For viral protein translation a. IRES is used in IBV to initiate the translation b. HA and A…
A: ANSWER;- d) The viral genomic protein found in the FMD virus is important to start the translation.…
Q: 23. Once a polypeptide chain has begun growing during protein synthesis, an incoming RNA carrying…
A: When protein synthesis has been started, each new amino corrosive is added to the lengthening chain…
Q: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST…
A: Amino acyl tRNA synthase functions to join appropriate amino acids with their corresponding tRNA.…
Q: 24. TRUE or FALSE: A microRNA (in red) binds to its mRNA target (black) as shown below:…
A: False The target will be cleaved.
Q: Met-enkephalin (Tyr–Gly–Gly–Phe–Met) is a painkiller and sedative (Section 21.5). What is a possible…
A: Metenkefalin could be an artificial kind of the naturally occurring, endogenous opioid amide,…
Q: 16. Eukaryotic initiation factor elF2B is a guanine nucleotide exchange factor. Explain why elIF2B…
A: The eukaryotic initiation factor elF2B is the guanine nucleotide exchange factor, which converts…
Q: 7a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…
A: DNA is the genetic material present in most of the living organisms. The DNA is made up of 4…
Q: 11. Consider a Lambda-DNA molecule, which has 48502 base pairs and a contour length o about 16.5 um.…
A: Introduction Lambda DNA, a linear, double-stranded phage DNA containing 12 bp single-stranded…
Q: 16) PROTEIN SYNTHESIS: A) Describe the process of protein synthesis. Be sure to use transcription…
A: Proteins are polymers of amino acids formed via peptide bond between two amino acids .
Q: 32. Would you expect to find hydrophobic amino acids on the external surface or internally in…
A: We are authorized to answer one question at a time since you have not mentioned which question…
Q: 14) (recall) A particular triplet of bases in the template strand of DNA is AGT. The corresponding…
A: During the method of transcription, the data encoded inside the deoxyribonucleic acid sequence of 1…
Q: 16)(comprehension) Suppose the following DNA sequence was mutated from 3'-AGAGAGAGAGAGAGAGAG-5' to…
A: The central dogma states that DNA undergoes transcription to form mRNA which then gets translated to…
Q: 20. in differential translation, a different transcript may be recovered depending on which TATA box…
A: Translation: The process through which RNA codes for specific proteins is known as translation. It…
Q: Practice 26: Consider the following portion of mRNA: 3'-CUU-AAA-CGA-GUU-5' What is the primary amino…
A: Transcription is the process of synthesis of mRNA from DNA. During the translation process, the mRNA…
Q: 5’-AUGCCGGACUGAAAU-3’ What is the sequence of the resulting protein assuming the ribosome takes the…
A: The central dogma of molecular biology explains the flow of genetic information through the…
Q: Contrast DNA replication with gene expression (transcription→translation)—when does each occur?
A: DNA replication is the bio-process by which the double-helix DNA system is duplicated, whereas gene…
Q: 35. Transcription in eukaryotes requires which of the following in addition to RNA polymerase? A.…
A: Transcription means conversion of DNA to RNA chain. It requires several transcription factors for…
Q: 4a in context to taking genomic DNA from eukaryotic cells and randomly shearing it into pieces of a…
A: Renaturation is a process of reformation of hydrogen bonds between the complementary single strands…
Q: 9) In another mutation from the original wild-type sequence, the bolded G in the middle of the…
A: The DNA is transformed into proteins through the process of transcription and translation. The…
Q: POST-ACTIVITY SKIL 1. The E2F family of transcription factors is important in regulating the cell…
A: Transcription factors are protein molecules which bind to specific DNA sequences to regulate gene…
Q: 26. Once a polypeptide chain has begun growing during protein synthesis, an incoming RNA carrying…
A: Ribosomes synthesize proteins. Proteins are formed from amino acids. 70S ribosomal complex is…
Q: Which statements are true? Explain why or why not.1 The consequences of errors in transcription…
A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…
Q: 29. siRNA involves in: Gene degenaration Gene downregulation
A: Small interfering RNAs (siRNAs) are 20- 27 base pairs long double-stranded RNA molecules. It is a…
Q: . Transversion occurs when a purine is replaced by a pyrimidine. true or false
A: True
Q: Practice question: Page 112 Ex: 2 True of False Each answer must be justified with a short…
A: Explanation to D: - A sigma factor or also known as Specificity Factor is a protein needed for…
Q: 7. Accuracy in the translation of mRNA into the primary structure of a polypeptide, depends on…
A: To determine: To determine the accuracy in the translation of mRNA into the primary structure of a…
Q: Association for the Advancement of Science. Reprinted with permission from AAAS. FIGURE 6.13 16- 16…
A: RNA Folding and Unfolding: It's the process of a linear ribonucleic acid molecule acquiring…
Q: 11. Why is RNA polymerase a good name for this enzyme? Explain each part of the name: RNA, polymer…
A: Replication is the process which makes DNA from the parental strand of DNA. Transcription is…
Q: 21. mRNA serves as template for the synthesis of polypeptide. true or false
A: The translation process is by which organisms forms protein or a polypeptide chain.
Q: 30. How can one identify the presence of introns in a hybrid of DNA and mRNA? Give an example of…
A: Introns are non-coding sequences, whereas exons are coding sequences. Splicing is the process of…
Q: Exercise 1 The order of a molecule of mRNA is given like following. b. AAAUGUCAAACGAGGCCGAUCAUUAAACU…
A: Translation is the process where protein (amino acids) is synthesized from mRNA molecule that is…
Q: Mutated DNA Sequence #4 ТАСАС СТTGG CGACT АСТ... What's the mRNA sequence? (Circle the change) amino…
A: DNA is two stranded structure which make it own strand via replication process . It comprises of…
Q: 60) In case of human circovirus, in order to reduce mRNA for theit.D heel iD use two viral enzymies,…
A: *NOTE: Kindly repost for other questions Dear Student as per the guidelines we are supposed to…
Q: III. Discuss the following aspects of translation: 1. How does the location and timing of…
A: According to our guideline we can answer maximum 3 subparts of a question. So, you need to upload…
Q: 23. Contrast the “functional” size of the four major classes of biomolecules. Background: Up…
A: Carbohydrates, proteins, lipids, and nucleic acids are the four major biomolecules. Carbohydrates…
Q: Given the going with molecule of DNA: strand 1 – A T G C G C T A C G C A T–strand 2 – T A C G C G A…
A: In living organisms, the genetic instructions for growth, development, functioning, and reproduction…
Q: 12. Using the provided "Genetic Code-Reference" answer the following question. Based on the…
A: mRNA codon sequence-: 5'-GGU-ACG-CUA-3' Aminoacids sequence: Gly-Thr-Leu
Q: INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS…
A: The process of mRNA synthesis by using DNA as a template strand is called transcription. The process…
Q: Time (h) 1 3 6 12 Mouse thymus cells were treated with 10 micromolar dexamethasone to induce…
A: Chromatin is defined as the complex of DNA and protein which forms chromosomes inside of the nucleus…
Q: The process of attaching biological functions to DNA sequences is called?
A: DNA is present inside the nucleus.
Q: 32.) Translate the following mRNA into protein primary structure. Use the ONE-LETTER abbreviations…
A: Note: You have asked multiple independent questions and thus we have solved the first question for…
Q: 37. A portion of an mRNA attached to a ribosome reads: 5′ UUUGACCCCACG 3′ If a tRNA with an…
A: answer The tRna with which amino acid attached will enter A site will be CCC codon which codes for…
Q: 25. Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand.…
A: Transcription is a process in which the genetic information in the DNA is converted into RNA in the…
Q: 3a) Both DNA synthesis and RNA synthesis are carried out by polymerases that catalyze the formation…
A: DNA replication occurs in all living organisms and is essential for passing the genetic information…
Q: 1) Transcription and translation both involve an initiation, elongation, and termination phase.…
A: A gene is the essential physical and functional unit of heredity. Genes are comprised of DNA. A…
Q: 24. During the disassembly of a nucleosome which part of the nucleosomes is the first to be removed.…
A: The capacity of nucleic acids to guide their own reproduction from monomers makes them unique.…
Q: 13. Nucleoid Structure in Bacteria In bacteria, the tran- scription of a subset of genes is affected…
A: The DNA in prokaryotes is double-stranded and lies in the centre without an enveloped nucleus. The…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 08 Nucleoside and nucleotide analogs are two closely related classes of anti-viral drugs that inhibit viral DNA or RNA polymerase enzymes. What is their most common mechanism of action and why are they often referred to as "chain terminators"? Edit View Insert Format Tools Table A xd0 Paragraph v They are referred as chain terminators because the sturcutre when looked at does not contain a 3 prime end 31 8 8:10 EE O 6 nQUESTION: Transcribe the gene. Write out the correct sequence of m RNA bases. Notice that this is the same gene as in B above. Recall that in RNA, thymine (T) does not exist and uracil (U) takes its place. 3' ССА TAG CÁC CTT GTC ACA ACG TGT TCG TAG ACA 1 3. 4. 6. 7. 8. 9- 10 11 AGG AAC АТА ATA GTT AAC CTT TTG ATA ACA ТТА ACT 12 13 14 15 16 17 18 19 20 | 21 inwww D le C 3⁰ A B Indicate True (T) or False (F) for the following statements. Only use the letter (T/F) in the space provided 1. The name of this process is best known as Rho dependent termination 2. The enzyme C called DNA polymerase incorporates ribonucleotides into B called the mRNA False 3. The DNA region A contains inverted palindrome sequences which results in formation of a stem-loops structure 4. During this process, the structure D called terminating hairpin forms and increases the enzyme affinity which terminates transcription
- 15/doc.aspx?sourcedoc={dac0ebeb-b019-4578-911c-98.. Search (Option + Q) Review View Help Table O Editing er Av A =☆回 w Insert Format Tools Add-ons Help Last edit was yesterday at 8:08 AM TURN 100% Normal text Arial 11 BIUA E- 1E E E - E EX 2. 3 . 5. C Directions: Describe the process of DNA replication in the space below. Specifically reference the pictures in your answer. Your response will undergo a plagiarism check. Be sure to write your response in your own words. Be sure to reference and thoroughly explain: The relationship and importance of DNA replication and the cell cycle. The conservation of genetic information during replication. (Is it conservative? Semi-conservation? Dispersive? What does this mean?) The specific enzymes used in each step and indicate whether each of the enzymes is a synthesis reaction or a digestion reaction. Justify your answer through explanation. Identify the parameters and limitations of the enzymes working effectively. (What factors would limit or interfere with DNA replication?)ACTIVITY 7.3.2 1. Name differences between replication and transcription. 2. Write the sequence of the RNA transcribed from the following DNA: 5' GATCAATGCTAG 3' 3' CTAGTTACGATC 540 Shown below is the antisense strand of DNA. What is the amino acid sequence that corresponds to this code? 5' AAAGCATACCGG 3' Second letter G. UUU Phe UCU UAU) Tyr UGC Cys UGU UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUA UCA UUG Leu UG CAU His CGU CGC CGA CGG CU CUU CUC CUA CUG CAC Pro Leu Arg CCA CAA) Gin CCG CAG AAU AUU AUC lle AUA AUG Met ACG ACU AGU AAC Asn AGC Ser ACC ACA Thr AAA1 AGA AAG Lys AGG Arg GAU) Asp GGC GAC Ala GAA GGU GUU GUC GUA Val GCU GCC Gly GCA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a PRO-VAL-SER-PHE PHE-ARG-MET-ALA GLY-HIS THR-LYS d LYS-ALA-TYR-ARG First letter Third letterThird letter UCAG UCAGH CAC First letter Part 5: Coding Practice 1. Use this sequence of DNA to answer the following former test questions: 5'-- TTAATGGGACAGCTTGTGTAGAGG --3' a. What is the complementary strand of DNA? b. Using the complementary strand of DNA (your answer from part a) as the template strand, what is the transcribed mRNA sequence? C. What is the amino acid sequence translated from the strand of mRNA synthesized in part b (use the genetic code below)? Remember: i. Start codon! ii. Stop codon! bac ocent Seond letter UUU Phe UAU Tyr UGU UGC Cys UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp G C. UUA UCA UUG Le UCG [ CAU ] CAC CUU CGU His CUC C CGC ne. CCA Arg Pro CUA CAA CGA CCG CAG Gin CGG CUG AAU 1 AAC Asn ACU AGU [ [ AUU AUC Ile AGC Ser Thr A AUA AGA AGG ACA AAA Arg AUG Met ACG AAG GUU GCU GAU GGU Asp GAC GCC GGC GUC Val G GUA GCA Ala GAA GGA Gly GAG Glu GGG GUG GCG2. H. Gobind Khorana deciphered the genetic code by (1) chemically synthesizing DNA molecules of known sequence, (2) using this synthetic DNA as a template to produce RNA in a reaction involving RNA polymerase and dNTPs, then finally (3) using this RNA in an in vitro translation experiment with the ribosome and amino acyl-tRNA (aa-tRNA) building blocks to produce peptides. For each single-stranded deoxyribonucleotide sequence Khorana synthesized (shown below), a single polypeptide was produced in the in vitro translation step (3): (1) Synthetic DNA d(TTT)n d(CCC)n d(AAA)n d(GGG)n d(AAACCC)n d(AC)n d(ACA)n a. (2) RNA encoded by synthetic DNA (3) Peptide product composition polylysine polyglycine polyphenylalanine polyproline Equal F and G Equal C and V polycysteine Fill in the RNA sequences that were produced by RNA polymerase in column (2). b. When Khorana conducted this work, one looming question in the field was whether or not the genetic code is overlapping or non-overlapping. In a…Biol370 - Assignment #2 – Spring 2020: Replication - Transcription - Translation Due 3/10/2020 (Before the beginning of the class) Name ID Instruction: 1. Print this document (US-letter only) Fill the table below with the appropriate color (see coloring rule) 3. Complete and annotate the drawing in attachment (see page #2). Make sure all the listed terms are present in your final drawing! (graded using 5 randomly selected terms 2. This type of drawing makes only sense for Eukaryotes/Prokaryotes (circle one) because: or The annotation must follow the coloring rule : DNA in BLACK. RNA in RED. Proteins and AAs in GREEN. Complex structures with some DNA and/or RNA and/or Proteins in BLUE. Color Color Color DNA DNA pol III Stop codon RNA RNA polymerase 5'-UTR Peptide Helicase 3'-UTR Leading strand Topoisomerase CDS Lagging strand Ligase RBS Coding strand Primer Ribosome SSU Template strand -10/-35 Box Ribosome LSU 5'/3' ends (all) Transcription start AA-TRNA N-/C- terminal ends…pcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:Hello, I would really appiarte help appreciate help. This is a blank question so I am unsure why it was rejected immeditely the first time. Thank you in advance. Identify the type of mutation and how it would affect the protein made (amino acid) if the following changes occurred in the DNA antisense strand First codon change from TAC to TAT. Third codon change from ACG to ACA. Ninth nucleotide changes from G to T. Nucleotide with adenine (A) base inserted between 3rd and 4th nucleotide. Types of Mutation Changes in the Amino Acid 1. 2. 3. 4.SEE MORE QUESTIONS
