C++ for Engineers and Scientists
4th Edition
ISBN: 9781133187844
Author: Bronson, Gary J.
Publisher: Course Technology Ptr
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 7.5, Problem 7E
(File creation) Write a C++
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
using c++ programming :::::
16. (Pick 5 Lotto) Write a program to simulate a pick-5 lottery game. Your program should generate and store 5 distinct numbers between 1 and 9 (inclusive) into an array. The program prompts the user to enter five distinctbetween 1 and 9 and stores the number into another array. The programthen compares and determines whether the two arrays are identical. If thetwo arrays are identical, then the user wins the game; otherwise the program outputs the number of matching digits and their position in the array.Your program must contain a function that randomly generates thepick-5 lottery numbers. Also, in your program, include the functionsequential search to determine if a lottery number generated hasalready been generated.
FUNCTION AND ARRAY (C++ LANGUAGE)
Create a sequence program that will input names to the arrayName array and then display the
values in the array. Use a function for input values and display the values. (Create a program
where you can input the full name and also create a program where you can input only the first
name)
-input 5 names only.
- 2 functions
- 2 codes
upload code and output
(C Language)
Write a program that reads movie data from a CSV (comma separated values) file and output the data in a formatted table. The program first reads the name of the CSV file from the user. The program then reads the CSV file and outputs the contents according to the following requirements:
Each row contains the title, rating, and all showtimes of a unique movie.
A space is placed before and after each vertical separator ('|') in each row.
Column 1 displays the movie titles and is left justified with a minimum of 44 characters.
If the movie title has more than 44 characters, output the first 44 characters only.
Column 2 displays the movie ratings and is right justified with a minimum of 5 characters.
Column 3 displays all the showtimes of the same movie, separated by a space.
Chapter 7 Solutions
C++ for Engineers and Scientists
Ch. 7.1 - (Practice) Write array declarations for the...Ch. 7.1 - (Practice) Write correct notation for the first,...Ch. 7.1 - Prob. 3ECh. 7.1 - (Practice) a. Write output statements using cout...Ch. 7.1 - (Desk check) List the elements displayed by the...Ch. 7.1 - (Practice) a. Write a program to input the...Ch. 7.1 - (Practice) Write a program to input eight integer...Ch. 7.1 - (Data processing) a. Write a program to input 10...Ch. 7.1 - Prob. 9ECh. 7.1 - (Electrical eng.) Write a program that specifies...
Ch. 7.2 - (Practice) Write array declarations, including...Ch. 7.2 - (Data processing) Write an array declaration...Ch. 7.2 - (Data processing) Write a program that uses an...Ch. 7.2 - (Electrical eng.) Write a program that stores the...Ch. 7.2 - (Practice) a. Write a declaration to store the...Ch. 7.3 - (Practice) Write specification statements for the...Ch. 7.3 - (Desk check) Determine the output produced by the...Ch. 7.3 - (Practice) a. Write a C++ program that adds the...Ch. 7.3 - (Practice) Write a C++ program that adds...Ch. 7.3 - Prob. 5ECh. 7.3 - (Electrical eng.) a. An engineer has constructed a...Ch. 7.4 - Prob. 1ECh. 7.4 - Prob. 2ECh. 7.4 - Prob. 3ECh. 7.4 - Prob. 4ECh. 7.4 - Prob. 5ECh. 7.4 - (Electrical eng.) Write a program that declares...Ch. 7.4 - (Statistics) Write a program that includes two...Ch. 7.5 - Prob. 1ECh. 7.5 - (Practice) Run Program 7.10 to determine the...Ch. 7.5 - Prob. 3ECh. 7.5 - (List maintenance) a. Write a complete C++ program...Ch. 7.5 - Prob. 5ECh. 7.5 - (List maintenance) The following letters are...Ch. 7.5 - (File creation) Write a C++ program that creates...Ch. 7.5 - Prob. 8ECh. 7.5 - Prob. 9ECh. 7.5 - Prob. 10ECh. 7.5 - Prob. 11ECh. 7.5 - Prob. 12ECh. 7.5 - Prob. 13ECh. 7.5 - Prob. 14ECh. 7.5 - Prob. 15ECh. 7.6 - Prob. 1ECh. 7.6 - Prob. 2ECh. 7.6 - Prob. 3ECh. 7.6 - Prob. 4ECh. 7.6 - Prob. 5ECh. 7.6 - Prob. 6ECh. 7.6 - Prob. 7ECh. 7.6 - Prob. 8ECh. 7.6 - (Practice) Use the max_element and min_element...Ch. 7 - (Statistics) a. Write a C++ program that reads a...Ch. 7 - (Practice) Define an array named peopleTypes that...Ch. 7 - (Numerical) Given a one-dimensional array of...Ch. 7 - (Numerical) Write and test a function that returns...Ch. 7 - (Sorting) Read a set of numerical grades from the...Ch. 7 - (Numerical) a. Define an array with a maximum of...Ch. 7 - (Numerical) Using the srand() and rand() C++...Ch. 7 - (Statistical) In many statistical analysis...Ch. 7 - (Data processing) Your professor has asked you to...Ch. 7 - (Modify) Modify the program written for Exercise 9...Ch. 7 - Prob. 11PPCh. 7 - (Data processing) The answers to a true-false test...Ch. 7 - Prob. 13PPCh. 7 - (Data processing) Construct a three-dimensional...Ch. 7 - (Computation) A magic square is a square of...Ch. 7 - (Computation) Among other applications, Pascal’s...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.Similar questions
- Topic: Array Write a C++ program to store and process an integer array. The program creates an array (numbers) of integers that can store up to 10 numbers. The program then asks the user to enter up to a maximum of 10 numbers, or enter 999 if there are less than 10 numbers. The program should store the numbers in the array. Then the program goes through the array to display all even (divisible by 2) numbers in the array that are entered by the user. Then the program goes through the array to display all odd (not divisible by 2) numbers in the array that are entered by the user. At the end, the program displays the total sum of all numbers that are entered by the user. Sample output:arrow_forwardFile Handling with Array: C++ Language: Write a c++ program to read the data from the file into array and do calculation. Note: Take a general word problem which helps in others related questions.arrow_forwardProgramming Language: C++ I really need help with this question and I keep getting repost answers. Please, someone, help with a genuine understanding of the problem. Code two functions to fill an array with the names of every World Series-winning team from 1903 to 2020, then output each World Series winner with the number of times the team won the championship as well as the years they won them. The input file is attached, along with the main function and screenprint. Please note team names that include two words, such as Red Sox, have an underscore in place of the space. This enables you to use the extraction operator with a single string variable. The following resources are included: Here is main. #include <iostream>#include <fstream>#include<string> using namespace std; // Add function declarations and documentation here void fill(string teams[], int size);void findWinner(string teams[], int size); int main(){ const int SIZE = 118;int lastIndex;string team[SIZE];…arrow_forward
- c++ programme(look at images) An organization would like to store in an array up to 100 donations. A donation is a floating-point value. Write a program which reads donations and stores them into an array which is capable of only holding 100 floats. A value of -1 can be used to terminate the input. A sample run would be:Enter donation: 50.00Enter donation: 20.00Enter donation: 95.00Enter donation: -1As a result the array of donations would look like:Given this, using an additional array of 100 float pointers, sort the contents of the donations arrays without actually moving any data in the donations array.To do this, each element of the array of pointers should be pointing to the corresponding element of the donations array.Once this has been done, simply reorder the pointers to point to the elements of the donations array in ascending order. Your pointers array should look like this:Print out the collection of numbers sorted using the pointers arrayarrow_forwardFile Handling with Multi Dimension Array: C++ Language: Write a c++ program to read the data from the file into array and Calculate the rows and columns in the multi dimension. Take any problem of your choose.arrow_forwardc# (File of Student Grades) Create a program that stores student grades in a text file. The file should contain the name, ID number, class taken and grade of every student. Allow the user to load a grade file and display its contents in a read-only TextBox.arrow_forward
- Use C++ This program will read the contents of a file into an array and calculate various values based on the contents of the file. The program will make use of a two dimensional array that has 30 rows and 5 columns. You will be reading in the contents from a file. You will need to read the file name from cin. You will prompt for the file name with the prompt: Enter input file name The file will consist of up to 30 sets of 5 values. The values will all be double floating point values. readFile function One function you will be required to have is called readFile. This function will read the input file. Each read will read in 5 columns of information into the next available row in the two dimensional array. The first 5 values are read into row 0, the next 5 values will be read into row 1, and so on up to 30 rows of input. You will need to keep track of how many rows of input you have read in. This could be anywhere from 0 to 30. If there are more than 30 rows of input you should only…arrow_forwardC++: (using searching, sorting, and algorithm analysis) Write an application that allows a high school senior to choose their top 5 college choices and store them in an array of strings. The program should use a function to display the unsorted array of colleges. Then use a function to sort the colleges in ascending order then a function to display the sorted array.arrow_forwardWrite C++ statements to do the following: Declare an array to hold 7 floating values. Assign value 3.3 to the last element in the array. Display the sum of the first two elements. Write a loop that computes the sum of all elements in the array. Write a loop that finds the minimum element in the array.arrow_forward
- C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…arrow_forwardInstructions(C++) Write a program that reads a file consisting of students’ test scores in the range 0–200. It should then determine the number of students having scores in each of the following ranges:0–24, 25–49, 50–74, 75–99, 100–124, 125–149, 150–174, and 175–200.Output the score ranges and the number of students. (Run your program with the following input data: 76, 89, 150, 135, 200, 76, 12, 100, 150, 28, 178, 189, 167, 200, 175, 150, 87, 99, 129, 149, 176, 200, 87, 35, 157, 189arrow_forwardInstruction: Create a Java programming code that: Use if-else or switch-case statements.Apply the corresponding looping statement. Program Specification:1. Use two-dimensional array with size 7 columns and 5 rows.2. Seat numbers are populated during run-time and not hard-coded.3. User is asked to input a seat number.4. The chosen seat number is replaced by the letter X.5. Program displays a remark “Seat successfully reserved” when reservation is done. 6. The user is not allowed to reserve a previously reserved seat. Display “Seat istaken” remarks.7. The user is not allowed to enter an invalid seat number. Display an errormessage.8. The program continuously loops. Sample Output: 1 2 3 4 5 6 78 9 10 11 12 13 1415 16 17 18 19 20 2122 23 24 25 26 27 2829 30 31 32 33 34 35Enter seat number to reserve: 111 2 3 4 5 6 78 9 10 X 12 13 1415 16 17 18 19 20 2122 23 24 25 26 27 2829 30 31 32 33 34 35Enter seat number to reserve:arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- C++ for Engineers and ScientistsComputer ScienceISBN:9781133187844Author:Bronson, Gary J.Publisher:Course Technology Ptr
C++ for Engineers and Scientists
Computer Science
ISBN:9781133187844
Author:Bronson, Gary J.
Publisher:Course Technology Ptr
Algebraic Expressions – Algebra Basics; Author: TabletClass Math;https://www.youtube.com/watch?v=U-7nq7OG18s;License: Standard YouTube License, CC-BY
Python Tutorial for Beginners 3 - Basic Math, Mathematical Operators and Python Expressions; Author: ProgrammingKnowledge;https://www.youtube.com/watch?v=Os4gZUI1ZlM;License: Standard Youtube License