Concept explainers
To determine: The method of development of a transgenic mouse model with a particular neurodegenerative disease.
Introduction: A model organism is an organism which has about 90% genes identical to the humans and on which the studies of human diseases can be conducted. A model organism should be small and have short generation time so that biological studies can be conducted on them conveniently. Drosophila melanogaster and Mus musculus are certain examples of model organisms used to study human diseases.
To determine: The use of model organism to study the disease or look for new treatments.
Introduction: A model organism is an organism which has about 90% genes identical to the humans and on which the studies of human diseases can be conducted. A model organism should be small and have short generation time so that biological studies can be conducted on them conveniently. Drosophila melanogaster and Mus musculus are certain examples of model organisms used to study human diseases.
Want to see the full answer?
Check out a sample textbook solutionChapter 14 Solutions
Human Heredity: Principles and Issues (MindTap Course List)
- There are a range of ethical issues associated with cloning. However, many of these are not applied to cloning plants. Explain why the idea of cloning an entire plant is generally accepted while cloning an entire human is not.arrow_forward-What is DNA cloning? What is the common organism that the scientists use to do cloning (explain briefly how it is done) -What is Gene of Interest? -What are the ethical issues on Biotechnology?arrow_forwardGenetic Engineering Genetic engineering has been used in many different ways, such as human growth hormone for the treatment of pituitary dwarfism (recombinant DNA) plants engineered to be resistant to herbicides and pests an “antifreeze” gene inserted into some Atlantic salmon and halibut Select one of the examples of genetic engineering listed above and provide a description of the technology in terms of how it works and what steps are taken. Example: Brief description of the technology: Steps involved in achieving desired outcome:arrow_forward
- . Let’s say that you have incredible skill and can isolate the white and red patches of tissue from the Drosophila eyes shown in Figure 12-24 in order to isolate mRNA from each tissue preparation. Using your knowledge of DNA techniques from Chapter 10, design an experiment that would allow you to determine whether RNA is transcribed from the white gene in the red tissue or the whitetissue or both. If you need it, you have access to radioactive white-gene DNAarrow_forwardWhat is the advantage of using stem cells for genetherapy or gene editing?arrow_forwardWhat are the ethical concerns of using stem cells? CRISPR?arrow_forward
- Genetic information has become part of our culture and it is difficult to tell the difference between unmodified and genetically modified food sources such as plant and animals. After reading this module’s material regarding vectors in biotechnology, consider the potential for nanotechnology and scientific advancement.Research nanotechnology and its potential use in biotechnology. In one or two paragraphs, explain the potential advantages and disadvantages of nanotechnology in health care, agriculture, or industry and discuss whether you would or would not support further research.arrow_forwardthis is an example of biotechnology: In order to increase the yield of oil from canola, research focused on ways to reduce competition from competitor weed plants. Weeds can be controlled by spraying with a herbicide that interferes with biological processes, like amino acid anabolic reactions, in the plant cells. A mutant of canola that is resistant to herbicides is sometimes grown in fields that are sprayed with the herbicide. The majority of canola in Canada, though, is genetically modified to be resistant to herbicides. also use the link: https://youtu.be/VS3kcwgIwm0 Question: Evaluating Biotechnologies in Food Systems As we practice being able to describe choices in Biology you will use this consolidation task to organize details about the advantages and disadvantages of biotechnologies. In an ideal world, all solutions to improving our food system would have no negative consequences. But issues in Biology involve the interaction of many different factors and changes in one…arrow_forwardWhat are the advantages of human genome project?arrow_forward
- Northern blotting, RT-PCR, and microarrays can be used to analyze gene expression. A lab studies yeast cells, comparing their growth in two different sugars, glucose and galactose. One student is comparing expression of the gene HMG2 under these two conditions. Which technique(s) could he use and why? Another student wants to compare expression of all the genes on chromosome 4, of which there are approximately 800. What technique(s) could she use and why?arrow_forwardGenetic engineering has been used in many different ways, such as human growth hormone for the treatment of pituitary dwarfism (recombinant DNA) plants engineered to be resistant to herbicides and pests an “antifreeze” gene inserted into some Atlantic salmon and halibut pick one of the examples of genetic engineering listed above to expand on. Provide a description of the technology in terms of how it works and what steps are takenarrow_forwardBy whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model. You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos? You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA? 5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’ 3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’ After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning