Campbell Essential Biology (7th Edition)
7th Edition
ISBN: 9780134765037
Author: Eric J. Simon, Jean L. Dickey, Jane B. Reece
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 11, Problem 2SQ
A group of prokaryotic genes with related functions that are regulated as a single unit, along with the control sequences that perform this regulation, is called a(n) ____.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Provide a detailed description of gene expression and control in prokaryotes. Provide a detailed description of proteins critical for this process. (please hand draw a figure showing gene expression and control in prokaryotes and the proteins involved)
A number of mutations affect the expression of the lac operon in E. coli. Consider each genotype below and complete the table using “+” to indicate that the gene is expressed, and “−” to indicate that gene is not expressed.
The following gene sequence of nucleotides is found on the template (non-coding) strand of a molecule of DNA from a bacterial cell. The promoter of the gene is highlighted in bold letters and the +1 is underlined. Use the genetic code at the end of this packet to answer the following questions.
3'-AGGCATATTACGATGCCGGTACTTGATGATGACGGACCCATTATAGGACATATG-5'
a) What is the sequence of the mRNA strand that will be transcribed from this piece of DNA? Indicate which is the 5’ and which is the 3’ end of the mRNA.
b) What is the amino acid sequence that will be translated from this piece of DNA
Chapter 11 Solutions
Campbell Essential Biology (7th Edition)
Ch. 11 - Your bore cells, muscle cells, and skin cells look...Ch. 11 - A group of prokaryotic genes with related...Ch. 11 - The regulation of gene expression must be more...Ch. 11 - A eukaryotic gene was inserted into the DNA of a...Ch. 11 - How does DNA packing in chromosomes prevent gene...Ch. 11 - What evidence demonstrates that differentiated...Ch. 11 - The most common procedure for cloning an animal is...Ch. 11 - Prob. 8SQCh. 11 - Prob. 9SQCh. 11 - Prob. 10SQ
Ch. 11 - What is the difference between oncogenes and...Ch. 11 - Prob. 12SQCh. 11 - For each statement, identify which major theme is...Ch. 11 - For each statement, identify which major theme is...Ch. 11 - Prob. 15IMTCh. 11 - Study the depiction of the lac operon in Figure...Ch. 11 - The human body has a far greater variety of...Ch. 11 - Because a cat must have both orange and non-orange...Ch. 11 - Design a DNA microarray experiment that measures...Ch. 11 - Interpreting Data Review Figure 11.22 We can...Ch. 11 - A chemical called dioxin present in Agent Orange,...Ch. 11 - There are genetic tests for several types of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Genes can be transcribed into mRNA, in the case of protein coding genes, or into RNA, in the case of genes such as those that encode ribosomal or transfer RNAs. Define a gene. For the following characteristics, state whether they apply to (a) continuous, (b) simple, or (c) complex transcription units.i. Found in eukaryotesii. Contain intronsiii. Capable of making only a single protein from a given genearrow_forwardYou may wish to consult the genetic code above to answer the following question. A mutation has changed a portion of a protein coding gene that encodes a messenger RNA sequence. The original messenger RNA sequence is 5-AUGCCCAGAGCU-3' Which mutation is a nonsynonymous (missense) mutation that changes a single amino acid in the encoded protein? O 5-AUGCCCAGGGCC-3' O 5'-AUGCCCUGAGCU-3' O 5'-AUGCCCACAGCU-3 5'-AUGCCCCAGAGCU-3arrow_forwardConsider the expression “central dogma,” which refers to the flow of genetic information from DNA to RNA to protein. is the word “dogma” appropriate in this context?arrow_forward
- What could be the advantages and disadvantages of simultaneous translation and transcription in prokaryotes?arrow_forwardFor each of the following, identify whether that sequence or feature of a typical protein-coding gene would be recognizable in the specified molecule in a typical prokaryotic cell. 5' UTR in DNA? 5' UTR in mRNA? Shine-Dalgarno in DNA? Shine-Dalgarno in polypeptide? Promoter in RNA? Promoter in polypeptide sequence? Stop codon in mRNA? Stop codon in the polypeptide sequence? [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] > <arrow_forwardIf a prokaryotic gene coding region is 42 nucleotides long, beginning with a start codon and ending with a stop codon, how many amino acids will it have?arrow_forward
- Put the following steps of transcription in orderarrow_forwardThe following is a DNA sequence of gene Z. The underlined sequence represents the promoter for gene Z and the underlined and italicized sequence encodes the gene Z ribosome binding (RBS) site. Transcription begins at and includes the T/A base pair at position 60 (bold)arrow_forwardThe following double stranded segment of DNA is part of a protein coding gene. The segments in uppercase letters (ACTG) represent the exons. The segments in lowercase letters (acgt) represent introns. The lower strand is the template strand that is used by the RNA polymerase to make an RNA transcript. Draw or write-out a) the sequence of the primary transcript and b) the mature mRNA resulting from this stretch of DNA.arrow_forward
- Below is a DNA sequence of the coding strand for a small gene. This gene has no introns. +1 5'- TATAAGATGCGTAGGATGCAGCTGTTTCAGCAGCCACGGTCTCGGCCCAGATAGCAGATAATAAACACGC GTA-3 a. Is this gene for an eukaryote or a prokaryote? Give one reason (. b. How many amino acids are expected to be coded by this gene? c. There are five underlined nucleotide sequences, interpret the purpose of three of them ONLY?arrow_forwardIn general, why is it important to regulate genes? Discuss examples of situations in which it would be advantageous for a bacterial cell to regulate genes.arrow_forwardi)Describe a strategy for regulation of transcription in eukaryotes. ii)Explain how this strategy is different than what might be used by a prokaryote.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY