with oxygen 2 ATP B convert energy 38 ATP Aerobic Respiration Anaerobic Respiration without oxygen

Q: biologists were able to estimate that, on average, only 5 fisher kits (young animals) survived to…

A: Setting fishing limits, modifying fishing methods, creating aquaculture techniques, and identifying…

Q: When SARS-CoV-2 replicates in cells, mutations can occur in the virus’s genome. When mutations have…

A: Mutation  The replacement of one nucleotide base with other nucleotide base is known as mutation.

Q: What would happen to a polarized epithelial cell tissue if we added a calcium chelating agent…

A: Answer : if we assume calcium chelating agent externally to a polarized epithelial cell tissue then…

Q: 9. a. What fossil primate possesses traits of both anthropoids and hominoids? b. What are those…

A: Hominid is a sort of primate that has a place with the family Hominidae. In scientific…

Q: er? TEalUNET ENED Hh Short Height: 25% 8. In flies, long wings (W) are dominant to short wings (w).…

A:

Q: Consider the following statements and indicate whether each presents an idea of Jean-Baptiste…

A: The evolution is the change in the characteristics of a species over several generations. It mainly…

Q: What is true of linked genes? Choose all that apply: pts deducted for including incorrect answers…

A: Linkage explains why some traits are typically passed down in families. Because the genes for hair…

Q: Figure 1 shows a model of the electron transport chain found in the mitochondria of eukaryotes.…

A: The location of electron transport chain found in the mitochondria in  eukaryotic cell.

Q: Drosophila melanogaster, the common fruit fly, is a model organism due to the similar relationship…

A: In the Drosophila melanogaster due to similiar chromosome to humans and fruit fly the eye color…

Q: Which of the following muscles did he use?

A: Muscles are soft tissues. Many stretchy fibers make up muscles. Different types of muscles have…

Q: Discuss different systems of biological classification briefly.

A: Introduction In this question we will discuss about the different systems of biological…

Q: A critique is a genre of academic writing that briefly summarizes and critically evaluates a work or…

A: Critique analysis is evaluation of text, it is subjective writing. The purpose of critique is to…

Q: Describe Class I MHC pathway of antigen processing and presentation. Highlight the functions of the…

A: The process by which foreign antigens are displayed on MHC, or major histocompatibility complex…

Q: Most skeletal muscles contain which of the following? O fast twitch fibers O slow twitch fibers O…

A: * Skeletal muscle functions in voluntary actions hence called as voluntary muscle. *Skeletal muscles…

Q: One of the most widely used means of communication among insects is chemical communication. How do…

A: Pheromones is a chemical released by an animal which ultimately changes the behaviour of a another…

Q: Which microbiology test measures the use of LACTOSE? What color is positive in each?

A: Lactose is a naturally occurring sugar present in dairy products such as butter and desserts.…

Q: Diagram of Eukaryotic transcription process.

A: Eukaryotic transcription is the complex process by which eukaryotic cells transcribe genetic…

Q: Explain how the diameter of skeletal muscle fibers varies and what type of muscle tissue grows as…

A: A single muscle cell is made up of muscular fibres. They help in the control of the body's physical…

Q: 2. In the guinea pig, a locus controlling coat color may be occupied by any of 4 alleles with the…

A: Let suppose the coat colour is controlled by the gene A, As there are many traits for the coat…

Q: Can the frequencies of all genotypes in a population be determined directly with respect to a locus…

A: The dominant allele causes a dominant phenotype in an individual and is composed of one copy of any…

Q: Please answer fast What role do sigma factors play in prokaryotic transcription? Which sigma factor…

A: In prokaryotes (as in eukaryotes), transcription necessitates a partial unwinding of the DNA double…

Q: How can the heart be strong enough to pump blood up your legs against gravity?

A: The heart is incapable of pumping blood back up the veins in your legs and back to your heart on its…

Q: Outline the differences among the three most sophisticated lungsfound in modern animals: the…

A: The insect tracheal system is not dependent on the circulatory system in order to get the oxygen…

Q: In addition to anaerobic bacteria which other two examples did the narrator state that anaerobic…

A: Here I will give the two other conditions or states of anaerobic conditions.

Q: Test Metabolic process indicated by a positive test. Citrate Indole Catalase Urease Methyl Red/…

A: Citrate test- are used to detect the use of citrate by an organism.  Indole- it differentiates the…

Q: Enzymes are catalytic proteins or RNA molecules that accelerate chemical reactions. Substrates  are…

A: * Enzymes are proteins speed up chemical reactions by binding to substrate. *Enzymes are also…

Q: Adjusting the objective aperture is an important step to obtain phase contrast in TEM. Compare the…

A: The "objective aperture" is used for accepting a transmitted wave or one of diffracted waves to…

Q: Consider a person without any functioning plasma cells. What effects would this condition have on…

A: Plasma cells are round or ovoid cells that contain colored cytoplasm with a pale perinuclear area of…

Q: Define 'oestrus’ and ʻmenstrual cycles.

A: These are the characteristics of the oestrus cycle and the menstrual cycle: When the female is in…

Q: overlapping one another and amplifying themselves. Where do you expect to see bands of Primer dimer…

A: Primer dimers are commonly caused due to contamination of our DNA sample and can be observed as a…

Q: What are taxonomic aids? Mention some of the taxonomic aids for identification.

A: Taxonomy is the science of naming, describing, classifying organisms. The father of Taxonomy is Carl…

Q: Which group of animals have endoskeletons? Annelids and Mollusca Cnidaria and Ctenophora O Nematoda…

A: Endoskeleton is internal bone or cartilage structure of animals which have a vertebra and some…

Q: What did genera discussed the Enterococcus? Are the healthcare concerns, infections, and nosocomial…

A: DISCLAIMER "Since you have posted a question with multiple sub-parts, we will solve the first three…

Q: What kind of evidence would indicate that the ability to taste PTC is inherited? Why was it…

A: 1. The ability to taste PTC shows a dominant pattern of inheritance. A single copy of a tasting…

Q: I1. Electrical impulses in muscle fibers are called 12. Groups of muscle fibers are that are…

A: The movement of skeleton muscles is voluntary in nature and regulated by central nervous system.…

Q: Using tables 2.1 and 2.2 as references, fill out the following table. The first item is given as an…

A: Geological time scale Geological time scale is a representation of Earth's history.

Q: Transcription occurs along a_template forming an MRNA in the _direction. * O none of the above O 5'…

A: The central dogma explain how the DNA codes for the proteins which proceed in three stages namely…

Q: Which of the following would not involve part of the appendicular skeleton? O taking this test O…

A: The skeletal system in humans is composed of 206 bones and a few cartilages. These are grouped into…

Q: Which domain of the DNA polymerase has a role on correcting the position of the primer and the…

A: Introduction A domain is a specific physical region or amino acid sequence in a protein that is…

Q: What is required to form a phosphodiester bond withanother nucleotide ?

A: Biochemistry is the study of biochemical functions at the molecular and cellular levels using…

Q: alanine that would exist at the pH indicated below.

A:

Q: Is GG a genotype or phenotype? __________ What gamete(s) are possible from a plant that is GG?…

A: * phenotypes means observable physical properties of individual like organism appearance and…

Q: 14 15 16 8 10 12 6. 13 17 10 11 Male Female

A: Male :  * 1 is kidney * 2  is renal vein * 3 is ureter  * 4 is renal artery * 5 is testis  * 6 is…

Q: The megaspore mother cell of an angiosperm has a diploid chromosome number of 2n=32. This megaspore…

A: The embryo sex formation in angiosperm is very interesting and unique feature that follows a…

Q: Parent Cross: Blue-Eyed Male x Normal Female Blue-Eyed Female F1 Offspring Normal Male Normal Female…

A: Drosophila melanogaster. The position of the white eye gene, positioned at the x-chromosome of this…

Q: The genetic description of an individual is its genotype, whereas the genetic description of a…

A: Introduction Genetics is the study of genes and heredity, or how specific attributes or traits are…

Q: 23. Which form of carbon is found in hard sponges, corals, and clams, but not in Earth's atmosphere?…

A: Calcium carbonate, or CaCO3, constitutes more than 4% of the earth's crust and may be found all over…

Q: Gene 1 TACTTGTTTACATAACTTTGAATT Step 1. Transcribe the DNA to MRNA Step 2. Draw lines to separate…

A: Genes are known as the hereditary units of life. They encode different proteins that are utilized to…

Q: Formulate an informed opinion regarding Genetically Modified Organisms

A: Q. Formulate an informed opinion regarding Genetically Modified Organisms

Q: A team of investigators is out on a boat on a lake on a marvelous,sunny summer day, and they are…

A: Introduction  Ocean have totally different ecosystem as there are different factors that affect the…