Catabolism - draw the complete citric acid cylcle for myristate
Q: Explain how an enzyme could distinguish between the (now circled) equivalent positions in the above…
A: Aconitase is an enzyme that catalyses the conversion of Citrate to isocitrate. Aconitase is an iron…
Q: There is a proposal that pyrazole could protect against the damaging effects of alcohol on the liver…
A: Alcohol toxicity happens due to excess consumption of alcohol in short period of time. Oxidative…
Q: The pentose phosphate pathway occurs in the mitochondrion of tissues actively engaged in synthesis…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: Which of these are artificial sweeteners (Arts) and which are metabolized (Mtbs) by glycolysis?…
A: Artificial sweeteners are synthetic substitutes for sugars. These are sweet in taste and have less…
Q: A patient of African American decent came in due to vasooclusive symptoms, you suspect a condition…
A: Hemoglobin is a tetrameric protein that transports oxygen to the tissues and CO2 to the lungs. Each…
Q: For each pair of biomolecules, identify the type of reaction (oxidation‑reduction, hydrolysis,…
A: The glycerol is a 3-carbon structure. (C―C―C) To each carbon atom there is attached one -OH group…
Q: What percentage of molecules of peptide GGGG has no ionized groups (e.g. has BOTH protonated…
A: Amino acids: An amino acid can function as both an acid and a base because of its structural…
Q: When an inhibitor blocks a step in electron transport, all of the following are true except that Oa.…
A: ETC consist of four protein complexes called Complex I, II, III and IV that transport electron…
Q: Symport and antiport proteins must be active transport proteins A)True B)False
A: The biological membranes are selectively permeable. Transport across the biological membrane can be…
Q: An unknown sample was tested if there is a presence of lipid, after the test it shows that it is…
A: These are the various preliminary and qualitative tests to estimate the presence and nature of…
Q: Please depict a noncovalent interaction important for the function of lysozyme
A: The enzyme lysozyme aid in the breaking down of polysaccharides in the bacterial cell membrane. They…
Q: What is the role of HCO3 in the activity of pancreatic enzymes? 2. What factors are needed in the…
A: DISCLAIMER FOR MULTIPART Since you have posted a question with multiple sub-parts, we will solve…
Q: 4. Which of the following mutations would most likely keep the transitions of T state to R state in…
A: Amino acids are biomolecules that have a carboxyl group, an amino group and a side group linked to…
Q: true/false: Humans produce isoleucine using pyruvate as a starting material.
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Consider the following pairs of fatty acids and underline the fatty acid in each pair that will have…
A: Fatty acids are very important class of macromolecules in our body. They are the simplest type of…
Q: 3 Consider the reaction shown below and answer the questions that follow. HO-P-O-CH он HN DH H X…
A: DNA (deoxyribonucleic acid) is a type of nucleic acid which is composed of deoxyribonucleotides.…
Q: What are the general properties of Lipids? 2. How do Lipids vary from other macromolecules? 3.…
A: Lipids are a diverse class of naturally occurring compounds. Fats, waxes, fat-soluble vitamins,…
Q: 1- Catalyzes the production of FADH, in the Krebs cycle: a) isocitrate dehydrogenase b) aconitase c)…
A: The acetyl CoA molecules that are synthesized as the end product of carbohydrate, protein, and lipid…
Q: NH4+ is transported indirectly in the body. Why can’t free NH4+ be transported in the blood? How is…
A: NH4+ is the waste product formed from the amino acids on their catabolism. It must be transported…
Q: 3. After 24 hours of fermentation, no more CO₂ was produced in the presence of sucrose. Assuming…
A: Yeast performs alcoholic fermentation. Alcoholic fermentation is the process by which certain sugars…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: 1. Acetyl-CoA labeled with ¹4C in both of its acetate carbon atoms is incubated with unlabeled…
A: The citric acid cycle, also called as the Tricarboxylic acid (TCA) cycle is the central metabolic…
Q: 25) Which of the following is a section of mRNA produced from the DNA template below? 3'…
A: DNA and RNA are polynucleotides, in other words, they are polymers constructed using nucleotide…
Q: Electron transport chain. Complex 2
A: Electron transport is a succession of redox reactions, much like a relay race. It is a component of…
Q: In hepatocytes, the enzyme glucokinase catalyzes the ATP-coupled phosphorylation of glucose.…
A: In the reaction mechanism catalysed by glucokinase, glucokinase binds and brings ATP and glucose…
Q: How are GMOs applications of biotechnology?
A: Introduction:- The question is all about the genetic technology where genetic modification takes…
Q: Suppose a student rinses their buret with water instead of sodium hydroxide, leaving water in the…
A: Introduction The titration is a chemical process by which the quantity of one substance of a sample…
Q: 4. Shown below is the structure of the anti-retroviral drug AZT. 5' HOCH, H 3 N₂ HN AZT H 12 H CH₂…
A: AZT is a drug that is used to treat HIV. HIV is a retro virus that causes the syndrome AIDS. When…
Q: 4. Which one of the following requires an energy source? a. a large molecule transported with its…
A: Transport of molecules across the plasma membrane occurs through passive and active transport.…
Q: With regards to hemoglobin-oxygen binding, CO2 is a [Select] modulator and 2,3-bisphosphoglycerate…
A: Positive allosteric modulators of haemoglobin -oxygen binding are the agents that stabilise R state…
Q: Sucrase has an optimum temperature of 37°C and an optimum pH of 6.2. Determine the effect of the…
A: Since you have posted multiple questions with multiple sub parts, we will provide the solution only…
Q: One of your colleagues has obtained a sample of muscle phosphorylase b that is known to be…
A: Glycogen is storage-type homopolysaccharides that contain two types of glucose polymers: amylose:…
Q: Several of the enzymes of glycolysis fall into classes that What reaction participate in many other…
A: Enzymes are classified into different classes based on the nature of type of reaction they catalyse.…
Q: All enzymes of the citric acid cycle are located in the mitochondrial matrix, except succinate…
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: DETAILS 09 Select all of the following half reactions that require energy (work) to proceed as…
A: The reactions that require energy to proceed are called endergonic reactions. The half reactions are…
Q: Question 6 In membranes, one of the most common targets of reactive oxygen species are saturated…
A: Fatty acids are carboxylic acids with a hydrocarbon chain. Saturated fatty acids are fatty acids…
Q: 1. Describe five major types of lipids.
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: 2. Scheme of anaerobic oxidation of glucose and energy balance.
A: Organisms that live under anaerobic conditions rely only on glycolysis to generate ATP. Glycolysis…
Q: Explain the regulation of biochemical pathways. Describe the regulation of β-oxidation. Describe the…
A: Beta oxidation is the catabolic pathway of degradation of fatty acids to release energy. Urea cycle…
Q: a) Determine kcat (in units of sec-1) for a particular enzyme, given the following information: Vo =…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: A) List each of the five major functional classes of proteins. B) Discuss the function for each…
A: Amino acids are what makeup proteins. Protein structures are biopolymeric. Twenty amino acids are…
Q: Elaidic acid is an 18 carbon fatty acid with a trans double bond at carbon 9 that is produced in…
A: The major physical property of fatty acid is their melting point, which in-turn define at which…
Q: At pH 7, the most predominant interaction between glucuronic acid (structure seen below) and the…
A: Electrostatic interactions are the interactions that might be attractive or repulsive that form…
Q: Which of the following is a structure of a sugar alcohol? Н I I H O CAB O CAR O CAP COOH OH нон CAT…
A: Sugar alcohols are formed when the aldehyde or keto group of the monosaccharide is treated with a…
Q: The structure given below represents what molecule?
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: Which reaction or reactions of glycolysis require ATP as a reactant? List the enzymes that catalyze…
A: Glycolysis is a catabolic pathway in which glucose is broken down into two molecules of pyruvate to…
Q: II. Draw the different forms of the following amino acids in solution. 1. Proline (3 forms) 2.…
A: Amino acids are basic unit of polypeptide chain. Alpha carbon of amino acids contains carboxyl…
Q: Make a summary
A: Glucagon is a peptide hormone secreted by the pancreas in response to low blood glucose levels.…
Q: Kinesin movement is dependent on GTP hydrolysis. True False
A: Kinesin is a motor protein that is essential for the cellular functions like mitosis, transport of…
Q: II. Draw the different forms of the following amino acids in solution. 1. Proline (3 forms)
A: Since in the question, it is mentioned to write about the 3 forms of proline, only answer to that…
Catabolism - draw the complete citric acid cylcle for myristate
Step by step
Solved in 2 steps with 1 images
- catabolic pathway - draw the complete electron transport chain for myristateSteady state vs burst activity – why is aerobic better for steady state and anaerobic better for burstMetabolic Differences between Muscle and Liver in a “Fight or Flight” Situation. During a “fight or flight” situation, the release of epinephrine promotes glycogen breakdown in the liver, heart, and skeletal muscle. The end product of glycogen breakdown in the liver is glucose; the end product in skeletal muscle is pyruvate. (a) What is the reason for the different products of glycogen breakdown in the two tissues? (b) What is the advantage to an organism that must fight or flee of these specific glycogen breakdown routes?
- Ketosis in Dairy Cattle: 1. Explain why propionate can contribute to the next synthesis of glucose but acetic acid cant.Metabolic regulation (Ch. 15) 1. The Vmax of the enzyme glycogen phosphorylase from skeletal muscle is much greater than the Vmax of the same enzyme from liver tissue. (a) What is the physiological function of glycogen phosphorylase in skeletal muscle? In liver tissue? (b) Why does the Vmax of the muscle enzyme need to be larger than that of the liver enzyme?DG1: The F₁F - ATP synthase is a molecular machine that converts the proton motive force into enzymatic activity. a. Discuss the assembly of the F, subunit and describe the role each component plays in the function of the ATP synthase complex. b. Describe the proton path that results in rotation within the F₁F-ATP synthase. c. Explain how the F subunit contributes to the binding change mechanism.
- Substrate phosphorylation in the tricarboxylic acid. (TCA) asapaestion How does myoglobin minimize oxidation of the Fe(II) when the heme binds to oxygen? Select one: a. the distal His E7 forms a hydrogen bond to the bound molecular oxygen O b. the oxygen binding site is buried in the hydrophobic core away from water O c. the proximal His F8 forms a coordinate bond to Fe(II), which inhibits oxidation O d. nonpolar interactions with residues Val E11 and Phe CD1 limit oxidation by oxygen Oe. the heme shifts to a planar structure that traps iron in a +2 oxidation state Clear my choiceMatching Question: Match the following statements (designated I-1l) that describe various types of transport across biological membranes with the features of the corresponding processes: I. Free unassisted water diffusion through the lipid bilayer of the biomembrane. II. Glucose transport via the glucose transporter in the plasma membrane. III. Pumping of protons across the lysosome membrane by a proton pump similar to the ATP-synthase complex. Note that some of the items from the answer list should NOT be used. 1. Only 2 Only i1 v Process that requires a dedicated transmembrane transporter/channel v Process that occurs down the concentration gradient - Process that establishes a concentration gradient 3. Only i 41 and v Process that is energy dependent 51 and 6.Il and i 71. and iN
- Make a concept map using all of the following terms: GlycolysisOxidation of PyruvateCitric Acid CycleElectron Transport ChainChemiosmosisGlucoseOxidative Phos.Substrate level phosphatePyruvateacetyl-CoACO2OxygenWaterreduced elec. carriers (NADH)oxidized elec. carriers (NAD+)High enerGy Elec.Low enerGy Elec.H+ GradientADP + PiATPAdditional information: ATP production by the ETC and ATP Synthase per glucose varies somewhat depending on the energy required to move NADH into the mitochondria and other energy uses for the hydrogen-ion gradient. Additional questions: 1.) How many ATP's are generally yielded by oxidative phosphorylation from the catabolism of one glucose? 2.) Summarize the total ATP's obtained from a single molecule of glucose, from start to finish? asapFo-F1 ATPase. The energy for ATP synthesis from ADP and Pi is provided by the downhill transport of protons through the rotary FoF1 ATP synthase (lecture 22). The enzyme has 3 a-b and 12 ‘c’ subunits. The mitochondrion maintains Df=180 mV (negative inside), pHin = 8, pHout=7, [Pi] = 3 mM and ADP is present as well. How much energy is available (from the proton electrochemical gradient) for ATP synthesis under these conditions (in kJ/mol)? What [ATP]/[ADP] ratio will be established at steady-state under these conditions? What would be the [ATP]/[ADP] ratio if the enzyme had only 9 ‘c’ subunits? Remember that full revolution of the crank (gamma subunit) produces 3 ATP.