Why could the acrolein test be used as a general test for all fats?
Q: Which of the following statements about gluconeogenesis is TRUE? Gluconeogenesis is one way to…
A: The term "gluconeogenesis" describes a collection of metabolic processes that take place in the…
Q: H3N. Amino acids are bonded together in a linear polymer to form peptides or proteins. A small…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: Discuss regulation of glycolysis and the citric acid cycle, including likely activators and…
A: Glycolysis and TCA cycle are the stages of aerobic cellular respiration. Glycolysis is the process…
Q: QUESTION 37 If glycogen synthase kinase-3 is active (check all that apply): O glycogen will not be…
A: Glycogen is a storage-type homopolysaccharide that contains two types of glucose polymers: amylose:…
Q: The inhibition of PFK-1 by ATP diminishes when the ADP concentration is high, as shown in the graph…
A: PFk-1 is an enzyme involved in glycolysis. It catalyzes the conversion of fructise-6-phoaphate to…
Q: 7) In DNA/RNA chains, what is the direction of synthesis?
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: Wobble hypothesis indicates that: a. fatty acids are degraded 2 carbons at a time. O b.…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: 3. Design an experiment to determine whether a protein is an ion channel or a transporter. Provide…
A: Membrane transport involves the movement of ions/macromolecules across the membrane via…
Q: The first step in the catabolism of most amino acids is which of the following? Transfer of alpha…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group linked to…
Q: Please calculate the number of ATP that can be generated from one molecule of the fatty acid shown…
A: Most of the body's fatty acids are oxidized by beta-oxidation. The oxidation of fatty acids on the…
Q: Tell why the citric acid cycle is obligately aerobic.
A: Glycolysis convert one 6-carbon molecule of glucose-6-phosphate into two molecules of 3-carbon…
Q: ½ O₂ + 2H+ +2 e → H₂O FAD + 2H+ + 2e → FADH₂ E'º = 0.816V E'º = -0.219V Calculate the AG" of the…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Q: The mismatch DNA repair mechanism is based on the fact that: O a. O b. O C. O d. The parental DNA…
A: Mismatch repair is a process in which mismatched nucleotides present in the complementary paired…
Q: What is the purpose of the non-cyclic photophosphorylation? To generate NADPH for the…
A: The photophosphorylation that occurs in the grana of thylakoids in a non cyclic manner in which both…
Q: describe the experiment that proved chemiosmotic hypothesis.
A: The chemiosmotic model of ATP synthesis states that ATP synthesis occurs by movement of protons…
Q: 16. The overall reaction for the glycolysis reaction is C6H₁2O6(aq) + 2NAD+ (aq) + 2ADP³- (aq) +…
A: Glycolysis is the breakdown (catabolism) of glucose into pyruvate with net generation of 2ATP and…
Q: Identify examples of a carbohydrate that is: unbranched, reducing monosaccharide
A: Chemically, carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: Explain how energy stored in pyruvate is converted into adenosine triphosphate (ATP) in eukaryotic…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: What is the committed step of pyrimidine biosynthesis? Include the names and structures of any…
A: Pyrimidines are nitrogenous bases found in nucleic acids. Pyrimidines are heterocyclic organic…
Q: po Which of the following non-covalent interactions is the driving force in the initial…
A: A protein's function depends on its structure. There are four levels of protein structure: primary,…
Q: Hydrolysis of dodecapeptide P with the enzyme trypsin affords the following fragments: Arg,…
A: Trypsin and chymotrypsin are the proteolytic enzymes that can cleave peptide bonds of proteins with…
Q: An individual's blood sugar is low. Assuming normal regulatory patterns, are the following ratios…
A: If the blood glucose level is low, we need to reduce the rate of glycolysis as there is insufficient…
Q: Why do we need to determine the extinction coefficient in order to calculate the initial velocity in…
A: Enzyme are proteins that catalyse biochemical reactions. A substrate binds at the active site of the…
Q: Which enzyme regulates the rate at which acetyl-CoA enters the citrate cycle? isocitrate…
A: INTRODUCTION:The primary function of the citrate cycle is to. convert energy available from the…
Q: BIOC 385 Biochemistry of Protein Synthesis Q11.4: Considering that binding of the correct tRNA to…
A: Translation is the process of protein synthesis. It occurs in the cytoplasm. Ribosomes have peptidyl…
Q: Draw the synthesis of the dinucleotide formed between ATP and GMP. The 5' triphosphate can be…
A: Guanosine Monophosphate kinase catalyze the phosphate transfer reaction in which the terminal gamma…
Q: Consider a situation where a mitochondrion contained a defective complex III that resulted in only…
A: Electron transport chain consists of a series of protein arranged in mitochondria membrane and…
Q: 3.5 An a helical, intracellular protein, ITSME, denatures at 80 degrees Celsius. Which of the…
A: Proteins are polymers of amino acid residues linked together via a peptide bond. The amino acid…
Q: Use a schematic diagram to briefly summarize the steps taken during the separation, isolation, and…
A: Milk is the secretion of fluid from the mammary gland, the milk is composed of ~88% water and ~12%…
Q: Give a detailed account of the tricarboxylic acid pathway and how it is regulated in eukaryotic…
A: The citric acid cycle (CAC), sometimes referred to as the Krebs cycle and the tricarboxylic acid…
Q: How many comparisons are needed to count the number of duplicates in a list? How many comparisons…
A: Codons are triplets of nucleotides (4 types of nucleotides, A, U, G, C) found on mRNA sequence which…
Q: Coupling ATP hydrolysis to glucose phosphorylation makes thermodynamic sense, but consider how the…
A: The two individual reactions i.e. glucose phosphorylation and ATP hydrolysis is given below, along…
Q: Discuss how the shuttle mechanisms for cytoplasmic NADH operate in eukaryotes.
A: Most textbooks mention that under aerobic conditions, NAD+ is regenerated in the ETC. But the…
Q: Beta oxidation generates substrates for cellular respiration through which of the following…
A: The body requires an ongoing flow of energy to carry out its functions. Several substrate molecules…
Q: 2. The sequence of starting region of one DNA gene is shown: 5' GCATATGGCTTTTCCGCCGCGGCGACGGCTGCGC…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: 1. What are the effects of a) amino acid composition and sequence and b) intramolecular and…
A: "Since you have asked multiple questions, we will solve the first three questions for you. If you…
Q: HOW MANY of the following five items represent modes of protein denaturation? 1.) heating a protein…
A: Proteins are biomolecules composed of amino acids. Amino acids are joined together through peptide…
Q: Cells have an intracellular [Ca²+] = 0.1 µM. If cells hydrolyzed 1 mol of ATP under standard…
A: Gibbs free energy change for the ion to move across the membrane (both chemical and electrical…
Q: Based solely on the amount of NADPH produced, what is the total number of photons of light that must…
A: In the photosystems, NADPH is produced by a series of reactions starting from absorption of photons.…
Q: Two villages depend on agricultural corn as their primary food source. Pellagra, a niacin…
A: Pellagra is a deficiency disorder caused due to lack of niacin in the diet. The disease is more…
Q: Please answer both Note :- Other wise down vote.
A: The reactions that involve biomolecules are called biochemical reactions. These occur inside the…
Q: Next exam will be on carbohydrates, protein equencing and enzymes iochemistry roblem Assignment…
A: Emil Fischer invented the Fischer projection, a method of representing the three-dimensional…
Q: An animal cell is capable of converting alanine into serine. What is the shortest pathway using…
A: Amino acids are classically considered the building blocks for the synthesis of proteins. The unique…
Q: Which is true about signaling receptors? They are transmembrane proteins that have binding…
A: Signalling receptors are the transmembrane proteins that span the plasma membrane of the cell. they…
Q: Which of the following statements concerning translation is NOT correct? O a. The first codon of…
A: Translation is the process of translating codons on mRNA into proteins. mRNA bind to ribosomes which…
Q: 9. In pre-historic earth, where there exist no protein enzyme, ribozymes (ribose enzymes) seems to…
A: The most significant molecules in cell biology are deoxyribonucleic acid (DNA) and ribonucleic acid…
Q: What do all fats have in common? A) they all have identical hydrocarbon chains B) they are acidic C)…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: Given this peptide chain: LYS – MET – ASP – THR – GLN – ARG- LYS – TRP – MET – LYS – GLU – VAL- ARG…
A: Using chromatography, a compound can be separated from a mixture of compounds. There can be various…
Q: Can human digest this trisaccharide?What bond is it between sugar B and sugar C?(be specific)
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: A 6-year-old boy is brought to the physician by his mother because of intermittent upper abdominal…
A: INTRODUCTION : Serum Chylomicron & its increased concentration - For the transportation of…
- Why could the acrolein test be used as a general test for all fats?
Step by step
Solved in 2 steps
- What are the advantages and disadvantages of using the Lieberman-Burchard Test for Lipidsdoes ribose-5-phosphate pass fehlings test? If not wy does it give a negative result?Draw the chemical reaction involved in each qualitative reactions of proteins. Ninhydrin test (ninhydrin solution) Xanthoproteic test (concentrated nitric acid) Millon’s test (Millon's reagent) Hopkins-Cole test (glyoxylic acid) Biuret test (Biuret solution)
- Give the chemical principles involved in a positive Biuret test, Millon’s Test and Sakaguchi Test. What is the chemical basis of the Ninhydrin Test, Hopkins – Cole test and Sulfur reaction test? What chemical structure should be present in an amino acid or protein to give a positive Xanthoproteic test?What test is used to differentiate glucose and galactose? Explain the answerWhat test could be used to differentiate between glucose and fructose? Explain
- Which test can be used to differentiate maltose and sucrose? Molisch Test Seliwanoff’s Test Iodine Test Barfoed’s Test Bial’s Orcinol Test Benedict’s TestWhat amino acid present in proteins is responsible for the reaction in Hopkins- Cole test ?Create an illustrated step-by-step schematic diagram of the following Qualitative test for Lipids: Baudouin Test Huble’s Test