Wobble hypothesis indicates that:a. fatty acids are degraded 2 carbons at a time.O b. 16S-ribosomal RNA recognizes Shine-Dalgarnosequence of the mRNA and thus initiates proteinsynthesis.O C.DNA replication is semi-conservative.d.the 5'base of anticodons may recognize 1, 2 or 3bases in the codons and thus only 31 differenttRNA molecules can recognize 61 codons.e. DNA replication proceeds bidirectionally.

As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…

Answered: Wobble hypothesis indicates that: a.…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

What is the role of ribosomes in protein synthesis? * A. they carry proteins to the site of action B. they provide a source of amino acids C. they provide a site from tRNAs to link to mRNAs D. they translate the basic DNA code using tRNA Consider the following DNA bases sequence 3' TAT CGG 5'. what dipeptide is formed if a DNA point mutation converts CGG to CGT? * A. Val-Ala B. Asp-Glu C. Ala- Ala D. Gly-Ala A tRNA molecule possesses the anticodon 5' CGU 3' , which amino acid will this tRNA molecule carry? * A. Threonine B. Valine C. Alanine D. Arginine What will most likely be the effect of the change in the DNA molecule? * A. the change will cause a harmful mutation B. the DNA molecule will be unable to replicate…
1.1 What is the best description of a Ribosome? a. An enzyme that uses ribose to synthesize amino acids b. A protein/RNA complex that synthesizes protein c. A ribozyme that uses RNA as an enzyme to directly ligate free amino acids to tRNAs d. A multi-subunit protein complex that charges tRNA with amino acids 1.2 In RNA processing? A. Exons are added to the ends of mRNA for protection B. Intron sequences are removed before the mRNA is translated C. The RNA transcript that leaves the nucleus may be much longer than the original primary transcript D. All RNA transcripts will be processed and leave the nucleus.
Which of the following statements below is incorrect? * A. the genetic code is overlapping B. the genetic code is universal C. degenerate codon specify the same amino acids D. the genetic code is triplet Which protein can break covalent bond? * A. Helicase B. Primase C. SSB D. DNA gyrase What is the complementary hnRNA base sequence produced from the DNA base sequence 5' C-T-A-T-A-C 3'? * A. 3' C-A-T-A-T-C 5' B. 3' G-A-T-A-T-G 5' C. 3' G-A-U-A- U-G 5' D. 3' C-U-A-U-A-G 5' Which of the following statements concerning the " cloverleaf" shape of tRNA molecules is correct? * A. four hairpin loops are present B. three hairpin loops and one open end are present C. two hairpin loops and two open ends are present…
Examine the following base sequence – 5’ UGA 3’. It represents the anticodon region of a particular tRNA. Based on this knowledge you know that a. This tRNA would be used to stop translation. b. This tRNA would carry the amino acid Serine to the ribosome. c. This tRNA would carry the amino acid Threonine to the ribosome. d. This tRNA would bind a TCA codon on DNA. e. This tRNA would not carry any amino acid to the ribosome. f. This tRNA would carry the amino acid Leucine to the ribosome.
49Eukaryotic RNA polymerases can be distinguished by their sensitivities to ( ). 50Each bacterial mRNA open reading frame has its own ( ) codon. 51Two nuclear splicing intermediates resemble ______________. A.helicesb.lariatsc.hairpinsD.projections
Match Column A with Column B. transports amino acids to the site of protein synthesis has anticodon loop directs amino acid sequence of proteins contains the Shine-Delgarno sequence synthesized in the eukaryote nucleus found inside the ribosome region where the RNA binds to the DNA template…
Suppose that section x, y, and z of the following hypothetical DNA strand are the exon (coding sequence) of one gene: 3’ CGC GGA TAT CTC GAG AAT TGT CTA 5’ x y z What is the structure of each of the following substances made under its direction? a. mRNAb. The polypeptide that is made using the given genetic information (use the genetic code)c. Suppose a mutation occurs, what is the resulting polypeptide sequence of the new DNA strand? 3’ CCC GAA TAT CTC GAG AAT TGT CTA 5’ x y z
. Given the following nucleotide sequence, 5’-CATTAGATCG-3’, find the correct complementary strand a. 5’-CGATCTAATG-3’ b. 3’-TGCCGAGCTA-5’ c. 3’-GTAATCTAGC-5’ d. 3’-CATTAGATCG-5’ Coupling of transcription and translation is found where? near type II RNA polymerase activity in prokaryotic cells within the eukaryotic nucleus at the ribosomal complex pls answer
In regard to the wobble hypothesis and the fact that cells do not need a full complement of tRNAs for codons. What would the consequences be if a cell lost the tRNA gene with the following anticodon sequences Please explain in depth A. 3'-ACA-5' B. 3'-CUG-5'
Genetic expression involves transcription and translation. Match the structure or molecule to the step. a. promoter region b. RNA polymerase c. antisense strand d. poly-A tail е. 5 саp f. splicing g. anticodon loop h. acceptor stem i. peptide bond j. A site 57. transcribed strand that will go on to translation 58. site where tRNA with amino acid enters the ribosome 59. intron sequences are removed and exons are combined together 60. site where amino acid combines with tRNA
What would be the direct consequence to a cell of loss-of-function of Elongation Factor-Tu (EF-Tu)? You may select multiple answers. a. tRNAs would fail to exit the E site after giving up their amino acid. b. The error rate of translation would increase. c. The ribosome would frequently fail to identify the correct start codon and initiation of translation would become less efficient. d. There would be no pause between the entry of a tRNA into the A site and peptidyl transfer.
1. DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’mRNA:polypeptide chain: 2. a. From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 6 3. a. From the given DNA sequence above, change the third base in codon 4 to show missense mutation. Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 4 4. a. From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 5. Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading…

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS