Which of the following statements is true about consensus sequences in DNA? Group of answer choices a consensus sequence is a technology for next-generation genomics consensus sequences are found in prokaryotes but not eukaryotes consensus sequences are considered 'junk DNA' with little biological relevance a consensus sequence reports the most common bases found in a specific nucleotide sequence

Which of the following statements is true about consensus sequences in DNA? Group of answer choices a consensus sequence is a technology for next-generation genomics consensus sequences are found in prokaryotes but not eukaryotes consensus sequences are considered 'junk DNA' with little biological relevance a consensus sequence reports the most common bases found in a specific nucleotide sequence

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 1TYK: Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a...

See similar textbooks

Similar questions

In 1984, Carolyn Greider was using to set up an experiment to find out the enzyme called telomerase that had the ability to add nucleotide repeats to telomeric region. * DNA oligonucleotide RNA oligonucleotide Crude E. coli cell extract none of the above [32P] dCTP DGTP
Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.
Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.
how many nucleotides are in CAGATTGTGAAGAGGTCTCTTGA consensus coding sequence? Answer in numerical digits only
A piece of DNA fragment is sequenced. You clone the the fragment, isolate the cloned DNA fragment, and set up a series of four dideoxy reaction. You then separate the products of the reaction by gel electrophoresis and obtain the following banding patter: ddATP ddTTP O 5'-ATTCGACT-3' O 5'-TCAGCTTA-3' What is the base sequence of the synthesized fragment? O 5'-AGTCGAAT-3' ddCTP O 5'-TAAGCTGA-3' I ddGTP
You are screen sharing Here is part of a gene: 5' TTTAATGGTAACCGTATTGCAGCTATTAGCATAAATG 3' AAATTACCATTGGCATAACGTCGATAATCGTATTTAC 5' 3' If the bottom strand of the DNA is the template strand, what will be the mRNA sequence and the amino acid sequence that are present in the protein? Copyright © 2010 Pearson Education, Inc.
Please help me make an abstract using the information below it is the result and discussion of the experiment, the abstract should contain 150 words. THANK YOU! In the laboratory, the researchers identified the parts of the DNA and RNA structure. DNA structures compose of a nitrogenous base, the base pair joined by hydrogen bonds, a deoxyribose sugar, and a phosphate group. The deoxyribose sugar attaches to a phosphate group to form the double-helix backbone of the DNA. On the other hand, the deoxyribose sugar is attached to either one of the four nitrogenous bases. These are either the purines (adenine or guanine) containing two carbon-nitrogen rings and four nitrogen atoms or the pyrimidines (cytosine or thymine) containing one carbon-nitrogen ring and two nitrogen atoms (Purines vs. pyrimidines, 2022). Each purine is paired with a pyrimidine resulting in an equal total number for each as stated by Chargaff’s rule. Each pair is called the base pair joined by a weak hydrogen bond…
The sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.
For #74 and #75, convert the DNA sequence into mRNA, and then the mRNA into protein (amino acids). Second mRNA base с A G UGU UGC DNA 74.mRNA 75. AA First mRNA base (5' end of codon) כ + A U GCT דווו UC JUA UUG CUU CUC CUA CUG ©2011 Pearson Education, Inc. Phe |Leu GUU GUC GUA GUG Leu AUU ACU AUC The ACC AUA ACA AUGMet or ACG + Val UCU UCC UCA UCG TTT CCU CCC CCA CCG GCU GCC GCA GCG Ser CAU CAC Pro CAA CAG Thr Ala ACG UAU UAC UAA StodJGA StorA UAG Sto UGG Trp G AAU AAC AAA AAG GAU GAC GAA GAG Tvr His Gln Asn Lvs Asp Glu AAC CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Cvs Arg Ser Arg Glv U CCT GUCAG Third mRNA base (3' end of codon) CGG
I have built an urn model for a DNA sequence. I have taken the letters from a sequence 1946 nucleotides long. The urn contains 259 Adenines, 699 Cytosines, 401 Thymines and 587 Guanines How many start codons will I find on average in the entire sequence when I draw all of the bases from the urn without replacement? Please I'm not too sure how to tackle this.
Compare and contrast the properties of DNA polymerase and RNA polymerase. Drag the appropriate items to their respective bins. can proofread using a 3'-to-5' exonuclease activity polymerize in a 5'-to-3' direction Only RNA can initiate strand synthesis catalyze phosphodiester bond formation to polymerize nucleotides into nucleic acids Only DNA use deoxyribonucleotide triphosphates as substrates can only extend an existing strand Both Reset Help dependent on a DNA sequence template use ribonucleotide triphosphates as substrates
The sequences of several short single-stranded DNA molecules are shown below. Imagine each sequence as a typical double-stranded DNA molecule, with antiparallel strands held together by Watson-Crick base- pairs between the complementary bases. Which of these double-stranded molecules would have the highest melting temperature (Tm)? 5' ACTGAGTCTCTGACTAGTCT 3' 5' ACTTAGTCTATGACTAGTCT 3' 5' ACTTAATCTATGAATAGTCT 3' 5' ACTGCGTCTCCGACTAGTCT 3' 5' ACTGCGTCTCCGACGAGCCT 3'