When a cell uses fats for aerobic cellular respiration, it first hydrolyzes (breaks down) fats to its component parts which are           Question 3 options:   sugars and glycerol glycerol and fatty acids glycerol and amino acids

Q: meaning of a life as a cell

A: Cell: It is defined as the fundamental unit of the life. It is the basic membrane-bound unit which…

Q: Name 3 industrial fishing practices, and explain how they result in bycatch and marine habitat…

A: The ocean of our planet is an area of large biodiversity. There are many yet to be explored…

Q: Vitamin list: Vitamins may be used more than once  Thiamin Folate  Riboflavin Vitamin B12  Niacin…

A:

Q: turtles, lizards, snakes crocodiles dinosaurs parental care keratinized skin amniote egg bipedalsm…

A: A phylogenetic tree is a diagrammatic representation which determines how taxons are related to each…

Q: describe the molecular switches involved during stationary growth phase

A: The growth of bacteria is proliferation of bacterium into two daughter cells, in a process called…

Q: What evidence did Darwin use to support his theory of evolution by natural selection? Describe…

A: Traits are inherited by offspring from their parents. Changes in these traits over a period of many…

Q: If two loci are 10 cM apart, what proportion of the cells in prophase of the first meiotic division…

A: Introduction :- In both mitosis and meiosis, the prophase is the first phase of cell division. When…

Q: How do you do a pedigree analysis for Family C all generations ?

A: Pedigree analysis is a useful way to study the inheritance of a trait or a disease that can be…

Q: Match the enzyme on the left with its role in DNA replication DNA polymerase l helicase DNA ligase…

A: DNA replication produces DNA molecule from the parental DNA molecule. It is catalysed by DNA…

Q: A histological specimen of submandibular salivary gland represents basket * cells from which some…

A: Introduction :- Saliva is produced by salivary glands and maintains strong teeth while also…

Q: I. Match the bacterium being described in column X with its best classification found in column Y.…

A: Although bacteria can survive at higher and lower temperatures than humans, they thrive in an…

Q: NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-30134-9 a b Transduction Puromycin…

A: In this work, CRISPR/Cas9 screen designed to identify restriction factors for SARS-CoV-2, assessing…

Q: Ozana was born with cataracts, which made her completely blind. When she was 14 years-old she…

A: Neuroplasticity, also known as brain plasticity, is the ability of the brain's biological, chemical,…

Q: )One girl in every two has brown hair. One girl in every three has dimples. What is the probability…

A: A: Probability of 1 girl in every 2 having brown hair is 1/2.B: Probability of one girl in every…

Q: How do you compute maximum assimilation (Amax) and what does the value tell you about the plant?

A: The transport of chemicals from digested food into the body's cells, ie., the process of absorbing…

Q: How does the mesophyll layer of corn differ from that of the privet (Ligustrum)?

A: The photosynthesis is responsible for production of organic molecules (carbohydrates)  by using…

Q: When a motile cell wants to change the direction of the movement; it remodels the actin under the…

A: The cytoskeleton proteins in the cells are responsible for different functions in the cells. The…

Q: Intracellular "wood chippers" known as break down proteins into component parts (peptides) so that…

A: MHC stands for major histocompatibility complex proteins. These are present on the surface of…

Q: Carl Woese has recognized that genes encoding rRNAs are excellent candidates for phylogenetic…

A: Genes encoding rRNAs are excellent candidates for phylogenetic analysis, mainly 16S small subunit…

Q: How can we determine whether predation is controlling the size of a population?  What are the…

A: There is basically inter specific competition type of interaction that exist between prey and…

Q: How might the molecules in the cells of Parent 1 be different from those in Parent 2 to produce the…

A: Phenotype refers to an individuals observable traits, such as height, eye colour, blood type and…

Q: How do you compute dark respiration (Rd) and what does the value tell you about the plant?

A: Photosynthesis is the process by which plants make their food. There are two ways by which plant…

Q: The increase in fast food establishments on Kirkwood Avenue is taking a deadly toll on the squirrels…

A: Cholesterol  A waxy, fat-like substance that the body requires in small amounts for good health.…

Q: Canthium wenzelii and Canthium sp. What will happen to the two Canthium species, which have their…

A: Canthium is a genus of flowering plants in the Rubiaceae family. They are small trees and shrubs.…

Q: To maintain muscle mass, in-season training should rotate between  maximal strength and power…

A: Simply said, muscle mass refers to the total quantity of skeletal, smooth, and cardiac muscles in…

Q: The brain is particularly sensitive to being shaped by input from the environment during sensitive…

A: Developmental psychology is a discipline of psychology that is concerned with the processes and…

Q: Questions 1. How does the patch-clamp technique help researchers study ion transport across cell…

A: NOTE: according to the answering guidelines, I am going to answer only first three parts of the…

Q: Explain how to prepare a rat and butterfly for dry museum preparation

A: The reasons for preserving the entire specimen in a collection might vary. Firstly, these specimens…

Q: The enzymes of the citric acid cycle are located in the  a. Inter membrane space of mitochondria…

A: The citric acid cycle is an important metabolic route that links the metabolism of proteins, fats,…

Q: 6. Describe the feeding biology of centipedes, spiders, mites and beetles. Compare and contrast…

A: Feeding biology of centipedes , spider, mites and beetles are  1.  Centipedes :-  They  are…

Q: Which of the following gene regulatory molecules act in cis. Check all that apply. The lac operator…

A: DNA is the genetic material in living organisms that contain specific sequence of nucleotides. The…

Q: Imagine that Species A and Species B are closely related species. Species A has one hemoglobin gene,…

A: Genes are the functional unit of DNA that is responsible for the production of RNA by the…

Q: How does a shunt benefit digestion in crocodiles?

A: Shunt It refers to the atypical blood flow through the heart. In spite of having an anatomically…

Q: In giraffes, long neck is dominant to short neck. Long neck is denoted by the dominant allele, N,…

A: The long neck is dominant over the short neck. Long neck is represented by allele "N" and short neck…

Q: Determine if the cells in telophase II of meiosis are haploid or diploid.

A: Cell division is the process by which the parent cell gets divided into daughter cells. In…

Q: What are the 5 spaces of the infrahyoid neck and the contents of each?

A: We know that The infrahyoid neck is the area of the neck between the hyoid bone and the thoracic…

Q: What is the difference between a nutrient pool and a cycling pool in the processes of matter flows…

A: The biogeochemical cycle refers to any natural process that moves components of living matter from…

Q: Impairment of intracellular calcium homeostasis in muscle fibers lead to chronic, severe muscle…

A: The sarcoplasmic reticulum(SR) regulates the amount of calcium in muscles. Following an increase in…

Q: How can this fusion be done? Can something be done using tissue engineering and 3D printers? What…

A: 3D printing:  The process where the biomedical structure in a three-dimensional form can be printed…

Q: Claire and Azalea were both infected with a virus known to harm prenatal development. Claire was…

A: The viruses are DNA or RNA containing organisms that behave like non-living materials outside of the…

Q: If a genetic female fetus is exposed to testosterone in utero, would that individual develop a…

A: Men have noticeably more testosterone on average than women, despite the fact that testosterone is…

Q: This type of ion channel allows K+ ions to flow into or out of a cell down its concentration…

A: The cell membrane is a semi-permeable membrane which allows only specific ions and molecules to move…

Q: Match the protein on the left with the type of activation of that protein on the right STAT Smad PKA…

A: The correct matches  of the  term mentioned in questions are shown below. STAT -  tyrosine…

Q: Which of the following is the best definition of a molecular marker? a gene that is likely to be…

A: a molecular marker  is a fragment of DNA that is associated with a certain location within the…

Q: Was it nutrient dense, empty or both –explain why? Explain which specific nutrients in the food make…

A: Gluten-free original pancakes are nutrient empty. spaghetti with tomato sauce meatless is nutrient…

Q: Which of the following individuals would you expect to share 25% of their DNA with you? Select all…

A: Answer :-  Your aunt or uncle  Your grandparents Your Siblings  These are the one which are the…

Q: Andi worked on a construction site for part of the time that she was pregnant with her daughter,…

A: Que 1- Is Abbi's  brain affected by the lead because lead is harmful for baby's brain development…

Q: 3d bioprinting systems, biomaterials, tissue engineering. Indicate 3 creative project topics on the…

A: 3d bioprinting :  The process that utilizes the living cells along with the biomaterial to produce…

Q: Assume that blood type is inherited as A and B dominant over O, but A and B are codominant over each…

A: Proteins for blood groupings such as A, B are present on the surface of red blood cells.

Q: GENETICALLY MODIFIED CROP: mRNA 5' tRNA nucleus O Į CAGTTAATGGAGCGATGCCTGGATGGAGAAATCAATTAG nucleus…

A: The genetic code is a set of instructions that enable live cells to produce proteins using genetic…

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.