There are base pairing rules for writing complimentary DNA strands for a given strand. A pairs with T C pairs with G In RNA, A pairs with U, instead of T. Write the complimentary DNA strand for each given strand of DNA. 1. CGTAAGCGCTAATTA 2. ТСTTAAАTGATCGATC 3. AATGAATAGCTAGCTT 4. GGCATTCGCGATCATG 5. CGTTAGCATGCTTCAT 6. АСТААСGGTAGСТАGC Now write the mRNA strand for the given DNA strand. 7. ATGTCGCTGATACTGT 8. GAAGCGATCAGTTACG 9. AATGAATAGCTAGCTT 10. GGCATTCGCGATCATG 11. CGTTAGCATGCTTCAT 12. АСТААСGGTAGCTAGC Write the tRNA sequence for the given strand of MRNA 13. AGGUCAUGCAUGGGCAUGCAU 14.AGAGAUUCAGCUAGCACGAUA 15.GUCAUCGAUCGAUCGGAUGCC 16.UUUCAGUCAGCUAGCGAUCGU Now you will translate the amino acid sequence for the given RNA strand. Remember codons are 3 base pairs long. 17. AUG CAC UGU CCU UUC GCU GAC
There are base pairing rules for writing complimentary DNA strands for a given strand. A pairs with T C pairs with G In RNA, A pairs with U, instead of T. Write the complimentary DNA strand for each given strand of DNA. 1. CGTAAGCGCTAATTA 2. ТСTTAAАTGATCGATC 3. AATGAATAGCTAGCTT 4. GGCATTCGCGATCATG 5. CGTTAGCATGCTTCAT 6. АСТААСGGTAGСТАGC Now write the mRNA strand for the given DNA strand. 7. ATGTCGCTGATACTGT 8. GAAGCGATCAGTTACG 9. AATGAATAGCTAGCTT 10. GGCATTCGCGATCATG 11. CGTTAGCATGCTTCAT 12. АСТААСGGTAGCTAGC Write the tRNA sequence for the given strand of MRNA 13. AGGUCAUGCAUGGGCAUGCAU 14.AGAGAUUCAGCUAGCACGAUA 15.GUCAUCGAUCGAUCGGAUGCC 16.UUUCAGUCAGCUAGCGAUCGU Now you will translate the amino acid sequence for the given RNA strand. Remember codons are 3 base pairs long. 17. AUG CAC UGU CCU UUC GCU GAC
Biochemistry
6th Edition
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Reginald H. Garrett, Charles M. Grisham
Chapter29: Transcription And The Regulation Of Gene Expression
Section: Chapter Questions
Problem 15P
Related questions
Question
can you help me
Expert Solution
Trending now
This is a popular solution!
Step by step
Solved in 10 steps
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
Recommended textbooks for you
Biochemistry
Biochemistry
ISBN:
9781305577206
Author:
Reginald H. Garrett, Charles M. Grisham
Publisher:
Cengage Learning
Biochemistry
Biochemistry
ISBN:
9781305577206
Author:
Reginald H. Garrett, Charles M. Grisham
Publisher:
Cengage Learning