Alternative splicingTemplate strand S F yIGUide1,mq00:c-00:ReplisomeTransforming principleOrigin of replication (or)eleb al msxS ainCoding strandTranscription factorsLeading strandSingle nucleotide polymorphismOkazaki fragmentTelomeraseMNucleosideRNA Polymerase IRNA Polymerase IIRNA Polymerase IIIon & of qu 9ven UoYInsertion mutagenesisSpliceosomeTranscription UnitSNPReverse transcriptase1Seminal work by Oswald Avery and colleagues demonstrated that DNA is what FrederickGriffiths called thisetniog OSdotsM bioW1-2kb of newly synthesized DNA strands are called thisainiog PSAssembly of the replisome is an orderly process that begins at these precise sitesSnoiteeu4Transcribes ribosomal RNA genes in eukaryotes5.A large nucleoprotein complex that coordinates activity at the replication forkSingle base pair differences between homologous genomic regions isolated from differentmembers of a populationComplex of proteins and snRNAs catalyzing the removal of introns and joining of exons8.A variation in a single base-pair in DNA as detected during genomic analysis9.Responsible for transcribing messenger RNAS that encode polypeptides.10DNA-binding proteins regulating spatial or temporal gene expression.11Different exons are joined together during pre-MRNA processing to produce slightly differentproteins when translation occurs12First identified in Tetrahymena, this enzyme adds short repeats to the 3' ends of DNA molecules13Nucleotide strand used for transcription14Strand of a DNA molecule having the same sequence as that in the RNA transcript15An enzyme that catalyzes the synthesis of a complementary DNA strand from an RNA template16A nitrogenous base linked to deoxyribose sugar17The new DNA daughter strand that is synthesized continuously18.Transcribes all tRNA genes.19A stretch of DNA that encodes an RNA molecule and the sequences necessary for itsranscriptionProcess by which a normal allele is rendered non-functional by insertion of a transposablelement.ENOPRSTUWABCDEFGHK

Telomerase Nucleoside RNA Polymerase I RNA Polymerase II RNA Polymerase IIIon E of qu sven UOY Insertion mutagenesis Spliceosome H Template strand SF yIGUnde1,mq00:c-00: Replisome Transforming principle Origin of replication (or)ele9b al msxa ain Coding strand Transcription factors Leading strand Single nucleotide polymorphism Okazaki fragment F Transcription Unit K SNP Reverse transcriptase 1 Seminal work by Oswald Avery and colleagues demonstrated that DNA is what Frederick Griffiths called this etniog OS 1-2kb of newly synthesized DNA strands are called this dotsM bioW 2 Assembly of the replisome is an orderly process that begins at these precise sites Snoiteeuo EZOPRSTUW× ABCDEEG

Telomerase Nucleoside RNA Polymerase I RNA Polymerase II RNA Polymerase IIIon E of qu sven UOY Insertion mutagenesis Spliceosome H Template strand SF yIGUnde1,mq00:c-00: Replisome Transforming principle Origin of replication (or)ele9b al msxa ain Coding strand Transcription factors Leading strand Single nucleotide polymorphism Okazaki fragment F Transcription Unit K SNP Reverse transcriptase 1 Seminal work by Oswald Avery and colleagues demonstrated that DNA is what Frederick Griffiths called this etniog OS 1-2kb of newly synthesized DNA strands are called this dotsM bioW 2 Assembly of the replisome is an orderly process that begins at these precise sites Snoiteeuo EZOPRSTUW× ABCDEEG

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 16P

See similar textbooks

Similar questions

BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
E D ot OH ON O Replication R SORO Transcription ORNA processing Translation Gene expression 657 F Q Search % T G LOCLE Y F7 & 87 F8 U 99+ 8 F9 53879 10 F10 O 2 H J K L CV BN MO < F12
48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letter
EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .
nd 2 minutes): Any RNA polymerase in any organism: O A Synthesizes RNA chains in the 3 to-5" direction O B. Binds tightly to a reqion of DNA located thousands of base pairs away from the transcobed rogion of the DNA OC Has proofreading activity O D. Separates DNA strands throughout a long region of DNA (up to tinousands of base pairs) and then copies one of them. OE Has a subunit called A (lambda), which acts as a proofreading ribonuclease OF. Can initiate synthesis of a new RNA chain without a primer
I ie luncu8k of RNA polymerase. \s a enzyme that is kesponsitae for copying a duyring He jprocess of transeve ip tion (2NA Sapglence DNA Seguence Into an 23. Describe the transcription process that results in synthesis of an RNA molecule.
pcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:
COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
11.5 A A Aa-AE-E-¹5- U - abe X₂ X² A-ay-A- Font Ulla Unigriffin DNA: mRNA: amino acids: traits: DNA: traits: mRNA: amino acids: · DNA: mRNA: to search #N O E Et CE- Paragraph $ 15 Ser 1. CAT AGG GAG | CAA GGG TGA CTT TTT | AAT AAT GAC GGG | A E ALT | CAA TTG TTA CGG | AAA AGA CCC | GCC ATA ACA TTT | % STP | CAC CGT CGA | GTA GTA | AGA GGG CAT | TTG TAA GGA GGG GGG TGT | 16 AaBbCcDc AaBbCcl AaBbCcL Aa BbCcDc 1 Normal 1 Body Text 1 List Para... 1 No Spac... W] Tyr 17 Val & 7 Gly E CO OM no num lk T Aa Bb Cc 1 Table Pa (p)) Styles 12 P
40 Shown below is the antisense strand of DNA. What is the amino acid sequence that corresponds to this code? 5' AAAGCATACCGG 3' Second letter G. UUU Phe UCU UAU) Tyr UGC Cys UGU UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUA UCA UUG Leu UG CAU His CGU CGC CGA CGG CU CUU CUC CUA CUG CAC Pro Leu Arg CCA CAA) Gin CCG CAG AAU AUU AUC lle AUA AUG Met ACG ACU AGU AAC Asn AGC Ser ACC ACA Thr AAA1 AGA AAG Lys AGG Arg GAU) Asp GGC GAC Ala GAA GGU GUU GUC GUA Val GCU GCC Gly GCA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a PRO-VAL-SER-PHE PHE-ARG-MET-ALA GLY-HIS THR-LYS d LYS-ALA-TYR-ARG First letter Third letter
3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.
What would the amino acid sequence be for the following DNA Transcript? 5’AAGCCATTTAAAGGC 3’ 3’ TTCGGTAAATTTCCG 5’ Phe Gly Lys Phe Pro Phe Leu Lys Phe Val Lys Phe Phe Lys Pro Lys Pro Phe Lys Gly More information is needed