III. DOUBLE MATCHING TYPEchoose theenzyme/protein/requirement in Column A, and the processes/stages where itoccurs in COLUMN B.Column AColumn BEnzyme/Proteins/RequirementsProcesses/StagesA. RNA polymeraseB. DNA polymerase IC. DNA polymerase IIID. Single strand binding proteinE. Sigma factorF. LigaseG. Peptidyl transferaseL Replication initiationi. Replication elongationiI. Transcription initiationiv. Transcription elongationv. Transcription terminationvi. Activation of amino acidsvii. Translation initiationviii. Translation elongationix. Translation terminationH. PrimersI. Aminoacyl synthetaseJ. GyraseK. Release factorsL Rho factorM. AUG-fmetN. Initiation factors

Answered: Image /qna-images/answer/572d6f9f-be59-453a-a513-7879f358f350.jpg

Answered: III. DOUBLE MATCHING TYPE choose the…

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 12RQ: Which of the following components is not involved during the formation of the replication fork?...

See similar textbooks

Similar questions

1. Highlight the relationship of gpll, gpV and gpX with the rolling cycle replication pattern of M13. replication (bi-directional ori) host enzymes (+) infecting 8S. viral duplex DNA replicative form genome gene II nicks + gene II nicks completed + strand rolling circle strand replication circularization of completed + strand 00
6_c. In cancerous cells, CpG islands are: where intercalating agents are found demethylated methylated.
Second letter A G UCU UCC UAU. Tyr UAC. UUU1 Phe UUC. UUA UUG. UGC Ser }Leu UAA Stop UGA Stop UAG Stop |UGG Trp UCA UCG CAU His CUU CỤC CCU ССС ССА CGU CGC Arg Leu CÁCS Pro CỦA CUG CGA CAAGIN CGG, Gln CAG, CCG J AAU Asn ACU АСC АСА AUU AGU Ser AUC }le A AUA AAC. Thr А AGC AGA AUG Met | ACG ] AAG Lys AG. GUU GUC GCU GAU1 AAsp GACS Ala GAA GGU GGC GCC Val Gly GGA G GUA GCA GUG GCGJ GAG Glu GGG Which peptide is the least likely to be made on the ribosome and why? а. Third letter DUAG 5UAG DUAG DUAG First letter
BONUS: Why do RNA viruses such as the COVID coronavirus, influenza virus and HIV have much higher mutation rates than DNA viruses such as Herpes viruses? O DNA polymerases which copy viral RNA have much higher mutation rates than RNA polymerases which copy viral DNA O RNA polymerases which copy viral RNA have much higher mutation rates than DNA polymerases which copy viral DNA RNA viral 60S ribosomes make many ore mutations than DNA viral 40S ribosomes O RNA viral gyrases make more mistakes than DNA viral helicases
ocument/d/1J-wo90GpYsd_jQSUBtDQHWisqGvSOteUQYoXaXazyS0/edit uction to cell.. R 1 Summary of Philo... E Petrona Andres Mig.. 2 Translations IXL: Par... IXL - Translations: g.. 1 IXL- meostasis Lab Exercise Tools Add-ons Help Last edit was 2 days ago text Calibri 12 BIU Conclusion: 1. List the changes you observed in the body color and perspiration level in response to? 2. Explain how the changes help the body adjust to maintain equilibrium (homeostasis)? 3. Speculate why a change in body temperature occurs? 4. Name which mechanisms your body uses to maintain a constant body temperature? 5. Explain why an increased breathing rate accompanies exercise? 6. Explain why an increased heart rate accompanies exercise? 7. Write a paragraph about the conclusions you can draw about your body's ability to maintain equilibrium (homeostasis). Be sure to include the answers to the questions above.
BONUS: Why can't RNA viruses use cellular RNA Polymerase to copy their genetic information? Because cellular RNA Polymerases are O RNA Dependent RNA Polymerase O RNA Dependent DNA Polymerase O DNA Dependent RNA Polymerase O DNA Dependent DNA Polymerase prt s home
AUG Met ACG ANALYSIS ANALYSIS: A DNA strand undergoes all the process included in the central dogma. The DNA strand used as a template is given below: Parent strand DNA: 5-AGA-ACT-AAA-СТА-ТCG-СТT-CGT-3 DNA daughter strand: hnRNA: MRNA: original protein: mutated MRNA: mutated protein: second letter G UCU UUU Phe UAU Tyr UGU UGC Cys UAA stop UGA stop| A UAG stop UGG Trp UUC UCC UAC Ser Leu UCA UUG UUA UCG G CUU CCU CAU CGU His CAC CAA CUC C CGC Leu CUA Pro Arg A ССА CGA Gln CAG CUG CCG CGG AUU ACU AAU AUC lle A AUA AAC Asn AAA AGC AGA AGU Ser ACC Thr АСА AAG LyS GAU ASP AUG Met ACG AGG Arg G GUU GCU GGU) GUC GCC GAC GGC Val GUA GCA Ala GAA Gly GGA A Glu GUG GCG GAG GGG G Translating the unmutated MRNA that was obtained after splicing, the original protein sequence will be? The original protein is [A] (For your answer, use the one-letter symbol (all caps) for the amino acid residues separated by dashes, e.g. C-A-S-H). first letter third letter
2. Here is the detailed view of the MCS of the PUC19 plasmid: Sma I KpnI SbfI PstI SacI XbaI ECORI BamHI Sall SphI HindIII agt GAATTCGAGCTCGGTACCCGGGGA TCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGcgtaatcatggtcat 400 410 420 430 440 450 460 ...S N S SP VR PDEL TS R CAH LS P T IM T M lacZa translational start Figure 25: MCS of PUC19 A. If the MCS were cut with Kpn I and BamH I, draw the small fragment of DNA that would be cut out. Show both strands. For reference, here are the recognition sequences: 5' G|GAT СС 3' 3' С СТАG|G 5' recognition sequence for BamH I 5' G GTAC|C 3' 3' cl CATG G 5' recognition sequence for Kpn I Figure 26: recognition sequences for BamH I and Kpn I
of estion 9 t of uestion THCA ▶ Sou 100- HC This reaction is Entropy is THC San Leafly ATA RNA polymerase SSSSSSSSSS ATTOGOGACATAA ATGACGGATCAGCCOCAAG UACUOCCUAGUC RNA Transcript TACTOCCTAGTCGGCOTTCOOCTTAACCOCTOTATIT (In this picture, RNA is being made by complementary base pairing with DNA.) This reaction is → Entropy is ◆
17. Animal viruses: Describe the replication cycle of a retrovirus like HIV (Human immunodeficiency virus). You may draw or describe the cycle. Be sure include how HIV carries out the steps of replication/multiplication from attachment/adsorption through release.
Which of the following components is not involved during the formation of the replication fork? single-strand binding proteins helicase origin of replication ligase
DNA replication requires ________ . a. DNA polymerase c. primers b. nucleotides d. all are required

SEE MORE QUESTIONS

Recommended textbooks for you

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biology: The Unity and Diversity of Life (MindTap…

Biology

ISBN:

9781305073951

Author:

Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biology: The Unity and Diversity of Life (MindTap…

Biology

ISBN:

9781305073951

Author:

Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

Biology

ISBN:

9781305967359

Author:

STARR

Publisher:

CENGAGE L

SEE MORE TEXTBOOKS