Table 4. Ligation of Sequencing adaptor to digested genomic DNA Components Amount Mspl or Hpall-digested gDNA Sequencing Adaptor (5μM) 250ng You will add adaptor to a final concentration of either 0.5 or 1μM - please ask the laboratory supervisor 1 X in final reaction Volume (to 20μl) 2X Quick ligation buffer Water to a final volume of 19μl Before adding the DNA ligase, heat the sample to 55°C and cool to 22°C over 1 hour Quick Ligase 1μl ابرا
Q: Consider the fatty acid arachidonic acid, which has the structure shown below. Which of the…
A: Arachidonic acid is a 20-carbon fatty acid. It has 4 double bonds in its structure in the cis…
Q: All amino acid side chains can be characterized by what? a. unique hydrophobic or hydrophilic…
A: Amino acids are biomolecules where an alpha-carbon is bonded to 4 different groups, which are; an…
Q: 3. Mutarotation refers to change in (A) DH (B) Optical rotation (C) Conductance (D) Chemical…
A: The answer is (B) Optical rotation, as mutarotation refers to the change in the optical rotation of…
Q: Describe how temperature affects the rate of an enzymatically catalyzed reaction.
A: All proteins are composed of monomers called amino acids. The amino acids form particular bonds with…
Q: What are the products of the TCA cycle and the oxidation of acetylCoA 3 NADH, 1 FADH2, 12 ATP 4…
A: The Krebs cycle also known as the TCA cycle includes a series of oxidation-reduction reactions that…
Q: A researcher is preparing a reaction mixture to test the activity of a protein. They combine at room…
A: pH is the negative log of H+ concentration, where the H+ concentration is in molar (M) pH = -log[H+]…
Q: Generally speaking, what kinds of cells express MHC I, MHC II, or both? What is presented on MHC I…
A: While B cells and antibodies bind antigens directly, T cells can identify antigens only when they…
Q: What percentage of ATP is derived from fat versus carbohydrate when your participant is exercising…
A: The respiratory exchange ratio (RER) is a measurement of how much oxygen (O2) is absorbed and how…
Q: Using the list of enzymes given below, provide all chemical structures and reactions for complete…
A: Since you have posted multiple questions, we will provide the solutiononly to the first question as…
Q: Could you help me with the remaind of the reactions F to H? See picture of the mechanism below.
A: In arrow pushing mechanism: the tail of the arrow represents where the electrons are coming from…
Q: 5. What is the strength of a medicine when mixed with 40 mg in 100 ml of total solution?
A: The dosage of a medicine is typically calculated based on the patient’s weight and the prescribed…
Q: How many Calories should there be in three grams of pure sucrose? C. 18 A. 4 B. 12 D. 8 E. M
A: Sucrose, the common sugar, is a disaccharide made up of glucose and fructose linked via a 1-1…
Q: 7. Give Brief explanation of Phase I reactions of detoxification.
A: Detoxification is a vital process that the body undergoes to eliminate harmful substances or…
Q: Using good details, compare and contrast the pairs of different biochemical reactions. Create your…
A: Hi, since you have asked multiple questions, as we are authorized to solve one main question at a…
Q: Table 3 - Determination Tube # Potato Expt. Temp. 2c 3c 4c 5c extract (mL) 2 2 2 2 room temp 20 °℃…
A: Enzymes are protein in nature serve as biological catalysts in living things. By decreasing the…
Q: 1) a) Sketch an A-form helix and a B-form helix, highlighting the differences between them. Indicate…
A: Since you have posted a question with multiple sub-parts, we willprovide the solution only to the…
Q: What type of polymer is being formed in Reaction #3? Name an enzyme that can catalyze Reaction #3.…
A: Polymers are high molecular-weight compounds made up of smaller molecules linked in a chain-like…
Q: 2) Which type of chemical reactions are the cytochrome P450 enzymes involved in? a. Oxidation b.…
A: Detoxification is a vital process that the body undergoes to eliminate harmful substances or…
Q: a) The molecule below is a/n: amino acid dipeptide tripeptide (circle one) b) Would the molecule…
A: Biochemically, amino acids are biomolecules with a carboxyl group, an amino group and a chemically…
Q: 8. What is the name of the reaction (below)? 9. Is reaction below an oxidation reaction or a…
A: Pyruvate is small organic molecule, the key intermediate in the metabolic pathway known as…
Q: What is the use of potential (mv) when graphing ATP concentration, NADH concentration, oxygen…
A: The usage of potential (in millivolts, mV) is often not immediately important when graphing ATP…
Q: 9. Draw the structure of the product that would form by the action of a PLP-requiring amino acid…
A: Amino acid racemase is an enzyme that catalyzes the conversion of one enantiomer (chiral isomer) of…
Q: 1. Activation or inactivation of certain key regulatory enzymes is accomplished by covalent…
A: The question asked to identify the amino acid that is commonly subject to covalent modification for…
Q: Fatty acids are activated for breakdown through the action of acyl-CoA synthestase. Which of the…
A: Fatty acids are oxidised in the mitochondria. The fatty acid cannot enter the mitochondria but fatty…
Q: 3. دیا Fill in the table defining the stages, purpose, and product of cellular respiration. ✓✓✓…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP the energy…
Q: Please draw all of the structures of the intermediates and names of all reactants, intermediates and…
A: Glycolysis is the metabolic pathway that stepwise oxidises glucose to pyruvate to produce ATP and…
Q: Whats the difference of glycogen functions and metabolism between the liver and muscle? please…
A: Glycolysis and gluconeogenesis are two metabolic pathways that are involved in the regulation of…
Q: 31. Explain the important biochemical functions of methionine and cysteine.
A: Methionine and cysteine are two essential amino acids that play vital roles in various biochemical…
Q: 8) Adrenergic receptors are the a. G-protein coupled receptor b. Ligand-gated ion channel c.…
A: Receptors are specialized proteins found on the surface of cells or within cells that are…
Q: 6. Cyanide is a poison that works by inhibiting cytochrome c oxidase, which is a protein that uses…
A: ETC consist of four protein complexes called Complex I, II, III and IV that transport electron…
Q: How does extracellular pH, NADH, and ATP supply can affect catabolic processes in heterotrophs?
A: Catabolic reactions are metabolic pathways that break down big molecules into smaller ones while…
Q: A brain scan uses the radioisotope oxygen-15. The recommended dosage is 60 mCi. A supply of 250 mCi…
A: mCi is a measurement of radioactivity used in radio pharmaceuticals. The full form of mCi id…
Q: Given the active site below, which best describes the mechanism(s) of catalysis? 1 5 NH i 2 Mn2 "H₂N…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: 44. Effects of clofibrate. High blood levels of triacylglycerides are associated with heart attacks…
A: The high level of triglycerides, the LDL (Low-density lipoprotein), and VLDL(very low density…
Q: Label the horizontal axis. Consider two proteins: hexokinase has a pI ~ 4.5, and actin has a pI ~…
A: pI or the isoelectric point is the pH at which the net charge on the molecule is zero. Proteins are…
Q: Draw the structures of the products formed by hydrolysis of the following tripeptide at…
A: Hydrolysis of the tripeptide Val-Gly-Ile will be the three respective amino acid residues of the…
Q: Below is the O₂ binding curve for adult Hb in whole blood (containing BPG) shown in red (labelled…
A: The pO2 in lungs is about 13.3 kPa, whereas in tissues it is 4kPa. A protein that carries oxygen to…
Q: 9) The and the determines the function. of amino acids determine the a. properties, bonds, and order…
A: Proteins are the macro molecules that are made up of amino acids joined by peptide bonds. Peptide…
Q: 13. Explain about Air/H2O pollution.
A: Air and water pollution are major environmental issues that have significant impacts on human health…
Q: 6. Is reaction below an oxidation reaction or a reduction reaction? 7. Does this reaction produce…
A: In an oxidation reaction, the atom, ion, or molecule loses electrons. In a reduction reaction, an…
Q: Describe the digestion and absorption of dietary lipids.
A: The digestion and absorption of dietary lipids is a complicated process that will be discussed in…
Q: A researcher is preparing a reaction mixture to test the activity of a protein. They combine the…
A: pH is the negative log of H+ concentration. The H+ concentration should be in molar (M). 1 μM = 10-6…
Q: Explain Metabolic changes during starvation.
A: Starvation is a condition that occurs when an individual experiences a prolonged period of…
Q: Determine whether each of the following items are characteristic of either facilitated diffusion,…
A: Membrane transport refers to the movement of molecules or ions across cell membranes. Cell membranes…
Q: Sketch an illustrated model of a fatty acid micelle and label the polar and non polar parts
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. they…
Q: What are the different types of biomolecules involved in cellular signaling, and how do they…
A: There are several types of biomolecules involved in cellular signaling, each with its own function…
Q: Draw the Fischer projection for L-glucose. Drag the appropriate labels to their respective targets.…
A: Fischer projection is a way of representing the three-dimensional structure of a molecule in a…
Q: The solvent in this chromatography experiment is 75% butanol, 12% acetic acid, and 13% water. Is the…
A: Chromatography is a lab technique that is used for separating a mixture of molecules into individual…
Q: The pH vs charge graph for a triprotic amino acid is shown below. Please answer the following…
A: An amino acid with the ability to donate 3 protons (3 H+) is called a triprotic amino acid. The 3…
Q: A. An example of sulphur containing amino acid is (A) 2-Amino-3-mercaptopropanoic acid (B)…
A: The below answer explains the correct option for the question "An example of sulphur containing…
Hi, I need help filling in the table.
Step by step
Solved in 3 steps
- What is the meaning of proofreading activity ? O A. The polymerase checks for the correct incorporation of nucleotides at the 5'end of the chain B. The polymerase checks for the correct incorporation of nucleotides at the 3'end of the growing chain O C. The polymerase does not attach to an unspecific primer binding to the template O D. The polymerase is highly resistant to high temperatures, showing a prolonged half life O E. The Taq polymerase does not binds to the primer dimersB 6000 5100 Number of Fragment(s) 4000 100 pX 6000 bp 3000 A A 1500 2000 A B 10. Based on the restriction map of the above plasmid, determine the number of DNA fragment(s) and the size(s) of the fragment(s). Digestion with Enzyme A Enzyme B Enzyme C Enzyme A + B Enzymes A + C Enzyme B+ C Enzyme A + B + C Fragment size(s) in base pairsGiven: BamHI, cleaves after the first G: 5’ G GATCC 3’ 3’ CCTAG G 5’ AND BclI cleaves after the first T: 5’ T GATCA 3’ 3’ ACTAG T 5’ THEN -- Given the DNA shown below: 5’ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG3’ 3’TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC5’ i) If this DNA was cut with BamHI, how many DNA fragments would you expect? ii) If the DNA shown above was cut with the enzyme BclI, how many DNA fragment would you expect?
- Analyzing Cloned Sequences A base change (A to T) is the mutational event that created the mutant sickle cell anemia allele of beta globin. This mutation destroys an MstII restriction site normally present in the beta globin gene. This difference between the normal allele and the mutant allele can be detected with Southern blotting. Using a labeled beta globin gene as a probe, what differences would you expect to see for a Southern blot of the normal beta globin gene and the mutant sickle cell gene?Coding With the given coding strand perform the following 1. supply the correct non- coding strand 2. Identify the location of following restriction enzyme by enderlining it in the coding strands 3. Supply the correct non-coding strands for the two restriction enzymes EcoRi - 5' GAATTC 3'BamH1 - 5' GGATTC 3' 5' ATGCATGGTACGTAGAGTTCCATGAATTCGCCCCTATAGGGTAGCCGAGGATTCTATGCCCGAATGTC 3'For this activity you will draw out the first steps of the PCR reaction, using the following as a short template. Take a picture of your drawing and upload it to this Question. 5' TTGCGTACGTGCATGTGTGCACATATGTCC 3' 3' AACGCATGCACGTACACACGTGTATACAGG 5° In your upload submission be sure to include: 1. Label the 5' and 3' end of the template and each primer, and indicate the direction in which polymerization will take place. 2. Write the sequence of a 10 base pair Forward primer and a 10 base pair Reverse primer binding to the template strand. Add an arrow showing which direction polymerization will take place 3. Add a DNA polymerase to the drawing above showing where the polymerase will bind. 3. Draw and label a DNTP nucleotide. Show how this monomer gets incorporated into a new DNA strand?
- Can you help with 1a please HELPFUL INFORMATION: When performing classical Sanger or "dideoxy" sequencing, you set up 4 parallel reactions per template to be sequenced from a specific primer, with each of the four reactions containing a different dideoxynucleotide, and then the four reactions were run in a separate, adjacent lanes on a gel. 1a. Why couldn't you combine all 4 dideoxynucleotides with the primer and the template and do the whole reaction in one tube, and then run the set of fragments produced by the reaction mixture on a single lane in an acrylamide gel?The chromatogram shows fluorescent peak data from a dye-terminating nucleotide-sequencing reaction. The peaks are shown with shortest fragment on the left to longer fragments on the right. T •C A Select the DNA sequence that matches the data. 5-ТАТAСТТАСGAAGT-3' 5'-GTCCTACGGACGCG–3' 5'-ATATGAATGCTTCA–3' 5'-TGAAGCATTCATAT–3' 5-АСТТCGTAAGTATA-3'Examine the DNA sequence shown below. You have been tasked with designing Primers for PCR amplification of the whole fragment shown. Your colleague said that she would design one primer and came up with this sequence – 5’ TTGCATCG 3’. You, being a good scientist, need to confirm that her work is good. Where will this primer bind on the target DNA, and will this primer work as part of a pair to successfully amplify this fragment of DNA? 5’ CGATGCAATCGAGCTATGGCATATCATAAGCGATAGACAGATAGCA 3’ GCTACGTTAGCTCGATACCGTATAGTATTCGCTATCTGTCTATCGT a. It will bind to the bottom strand on the left side of the fragment, and is suitable to amplify the fragment by PCR. b. It will bind to the top strand on the left side of the fragment, but it is unsuitable to amplify the fragment by PCR. c. It will bind to the top strand on the right side of the fragment, but it is unsuitable to amplify the fragment by PCR. d. It will bind to the bottom strand on the right side of the…
- In the following gel showing stained bands of the Alu insertion sequence, what is the genotype of individual 2? 941 bp 641 bp->>> 1 2 3 4 5 6 Homozygous for the 641 bp sequence that does not contain in the Alu insertion Heterozygous, containing one 941 bp sequence and one 641 bp sequence O Homozygous for the 941 bp sequence containing the Alu insertionYou have two sewage samples that you want to check for the SARS Cov 2 viral load. Whichvariable would give you a good estimate?a. High Ct valueb. Low Ct valuec. High melting temperatured. Low melting temperaturee. None of the above The DNA fragments generated during a cycle sequencing reaction are separated by sizes usingcapillary gel electrophoresis. The determination of the actual sequence is based on detection ofa. fluorescently labelled ddNTPsb. the lengths of the fragmentsc. fluorescently labelled probesd. fluorescently labelled primers.1) Enhanced GFP protein has: An excitation peak at 488nm and emits maximally at 507nm. An excitation peak at 488nm and emits maximally at 587nm An excitation peak at 488nm and emits maximally at 567nm. An excitation peak at 458nm and emits maximally at 507nm. 2) A typical sequencing read will yield _____ nucleotides of unambiguous sequence. 1800-2000 3800-4000 2800-3000 800-1000 3) Sequencing primers should be designed to bind where? ~ 25 nucleotides upstream of the beginning region to be sequenced. ~ 25 nucleotides downstream of the beginning region to be sequenced ~ 60 nucleotides upstream of the beginning region to be sequenced. ~ 60 nucleotides downstream of the beginning region to be sequenced