State whether the animal is internally segmented, externally segmented, or both.   1. Fish 2. Grasshopper 3. Snake 4. Bird 5. Earthworm 6. Snail 7. Shrimp

Q: A hollow fiber enzyme reactor (HFER) consists of 5000 fibers. Each fiber has an internal diameter of…

A: Using hollow fibers, which are tiny, semi-permeable capillary membranes stacked in parallel array…

Q: The allele for color-blindness is carried on the X chromosome. Making color blindness (a recessive…

A: The inability to identify certain colour distinctions is known as colour blindness. The retina, the…

Q: The Choose... bases of the two strands. On the leading strand, Choose... enzyme attaches to DNA and…

A: DNA replication is a process by which new daughter DNA molecule is produced from the parental DNA.…

Q: coral

A: An organism in which the zygote develops into a discrete unit which then produces more units like…

Q: which heart valve is circle in the image

A: The primary organ of your circulatory system, a web of blood veins which circulates blood throughout…

Q: The following are the offspring produced by the cross of AaBBCc X AaBbCC, except: a. AABBCC b.…

A: Trihybrid cross is the cross between the two individuals of a species for studying inheritance of…

Q: These are examples of environmental factors that influence indoor fungal contamination: Outdoor…

A: Answer :- The indoor environment essentially affects general wellbeing. Sensitivities, disease, and…

Q: What are the clinical features of the common immunodeficiency disorders?

A: The immunodeficiency disorders restricts our bodies ability to defend against the infections and…

Q: 5. Very happy Escherichia coli cells reproduce on a 20 minute time frame (doubling or generation…

A:

Q: Which one is true for majority of baculoviruses used as biological control agents? O They have been…

A: Pathogens called baculoviruses harm insects and other arthropods. Viruses are often quite small,…

Q: Is protein synthesis necessary for short-term synaptic plasticity, long-term synaptic plasticity, or…

A: INTRODUCTION Synaptic plasticity This is the modifications in strength of synaptic transmission that…

Q: sweet peas, the given enzymatic pathway result to pigment formation in the flowers:…

A: The example shown here is the example of epistasis where one gene is masked that is suppressed by…

Q: Draw the gametophyte and sporophyte stage of each representatives of nonvascular plants. Label the…

A: The gametophyte stage and the sporophyte stage are the two separate phases of a plant's life cycle.…

Q: If individual A has children with a normal male without the trait, what are the chances that her…

A: The given pedigree shows a trait that is autosome linked and recessive.  Therefore, we have the…

Q: How are different touch receptors distributed over the body?

A: We realise that we have uneven distribution of touch receptors in the skin; some locations have many…

Q: batches of competent cells into electrocompetent cells for transformation. In the end, the competent…

A: We know that transformation is the alteration of cell by introducing foreign genetic material into…

Q: What are the functions of the ANS?

A: Autonomic Nervous System   There are three physically separate divisions in it: enteric,…

Q: 9. Use each of the following species concepts to write a claim about whether the dark and light fur…

A: Species are defined as groups of organisms that are similar to each other and are capable of…

Q: You are doing a genetics experiment with the fruit fly. In the "F1" generation, you cross two…

A: The alleles are the alternative forms of a gene that are located on the same locas of a homologous…

Q: You are working in a research lab with a drug that temporarily blocks the reuptake pump (Calcium-SR…

A: Calcium is an important ion that is necessary to transmit nerve impulses to the muscle fibers…

Q: Describe REM and non-REM sleep.

A: Introduction: Sleep is Natural transient condition of rest during which a person loses their ability…

Q: Which patient would you expect to be most likely to develop emphysema? 1) high alpha-1 antitrypsin…

A: Answer :- Option 2 is correct;  low alpha-1 antitrypsin and low phagocyte activity Because, Alpha-1…

Q: What role do mutations play in the fragment presented above? How is the mechanism of natural…

A: The abrupt changes in the DNA sequence is called mutation.Iit could be beneficial, harmful or…

Q: wn er Q6.2. Suppose the rate of plant growth on Isle Royale supported an equilibrium moose…

A: The number of possible organisms in a population is referred to as its size. The fundamental source…

Q: 000,000 500,000 Great Lakes Mallard Population Estimates 2,000,000 1.500.000 1,000,000 500 000…

A: A population is the group of individuals of a species present in a habitat.

Q: Describe how hroughout the Games, performance-enhancing drug testing became more rigorous and…

A: Performance enhancing drug test in sports competition has became a common practice. Athletes use…

Q: If the AaBBCc individual will be test-crossed, what is the probability that the resulting offspring…

A: Test Cross:  The cross between an organism with unknown genotype and a recessive parents is know as…

Q: गत 1. जीवों को वर्गीकत क्यों करते हैं? अ

A: Introduction: Living organism classification is the division of living organisms into several groups…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…

A: Given DNA strand:  5' - CCTATGCAGTGGCCATATTCCAAAGCATAGC - 3'

Q: spectrophotometer.

A: Definition:  It is defined as the branch of electromagnetic spectroscopy which is concerned with…

Q: trace the wastewater treatment (from incoming water to release) in a typical plant that handles…

A: Wastewater cause a demand for dissolve oxygen and water turbidity is also increase. To resolve this…

Q: How long is the number of days being symptomatic by ascariasis?

A: Introduction Ascaris lumbricoides, a kind of roundworm, is the cause of ascariasis, an infection of…

Q: THE STICKLEBACK FISH: An excellent model for understanding evolution in the wild at many level…

A: Evolution is an accumulation of genetic variations.

Q: 1. This picture below shows the external structures of the stem, how old do you think is this twig?…

A: Introduction  A twig is a very tiny, delicate branch that emerges from a tree or bush's main branch.

Q: Match the Proteins (amino acid sequences) with the correct Phenotype for your Schnodhopper.

A: In this simulation activity, you will examine the DNA sequence of a fictitious organism - the…

Q: Different Substances Added Non-nutritive Potting Soil With Non-nutritive potting soils All…

A: Biomass is organic material derived from living organisms like plants, animals and microbes. The…

Q: describe the environmental factors that influence indoor fungal contamination.

A: The indoor environment has a significant impact on public health. Allergies, infection, and…

Q: To what kind of injuries are cells susceptible?

A: Cell injury is basically defined as a sequence of events that occur when the stresses in the cell…

Q: Organisms interact with one another in an ecological relationship called co-evolution. Bird, bee,…

A: In the figure it can be seen that the two different species are interacting together. These…

Q: The proton pump in ETC is an active transporter. Where does it get the energy to pump protons…

A: 0n bacteria that collect energy via an electron-transport chain (ETC), the electron-transport pumps…

Q: Why does Valerie's blood from her peripheral, tumor and breast samples all show bands of DNA that…

A: Many contributory factors have been identified to cause the onset of cancers, that include exposure…

Q: Why is there a difference in the proportionate number of plants in each phenotypic class of the…

A: During gamete formation, different types of gametes segregate independently from each other. Here,…

Q: If a woman is heterozygous dominant and her husband is recessive for a genetically inherited trait…

A: A diploid organism having two different types of alleles is said to be heterozygous. Individuals…

Q: what is Epithelial Tissue?

A: A tissue is made up of a group of similar cells performing a particular function. There are 4…

Q: Why does the pentose phosphate pathway take place in the cytosol? O The reagent NAD* is only found…

A: The pentose phosphate pathway is an alternative pathway to glycolysis which generates NADPH and…

Q: Evolution Biologists define evolution as the change in the frequency of alleles (variations of a…

A: Introduction: Change in the heritable traits of biological populations over multiple generations is…

Q: In emphysema, there is: 1) fewer "walls" (or septa) between alveoli 2) many, smaller alveoli (3)…

A: Emphysema It refers to a chronic lung disease. This disease develops after many years of smoking.…

Q: When a white cat was crossed with a black cat and all off springs were brown in color. How do you…

A: Two copies of each hereditary component segregate during gamete creation, according to Mendel's…

Q: How can the yeast vector, YEP, containing your desired gene, be inserted into the host cell? Discuss…

A: YEp stands for Yeast Episomal plasmid is a shuttle vector. Shuttle vectors are vectors designed in a…

Q: 5. Very happy Escherichia coli cells reproduce on a 20 minute time frame (doubling or generation…

A: Bacteria are ubiquitous microscopic prokaryotic organisms which exhibit 4 different stages of growth…

Animal Phylogeny

Cladistics is a method of biological classification where organisms are classified based on their ancestors and their relationship with them. It is defined as the concepts and methods for determining the branching patterns of evolution and evolutionary history. Some scientists, however, have preferred the term phylogenetic systematics or phylogenetic taxonomy to emphasize the reliance on a phylogeny for classification. It is the most common and accepted method for classifying organisms.