QUESTION 6 The 'end replication problem' is an issue in eukaryotic cells with linear chromosomes. How do rapidly and continuously dividing cells, like stem cells, solve this problem? O a. Using the 5'-3' exonucleae activity of DNA polyermase. O b. None of the above. O c. Recruitment of Telomerase to the chromosome ends. Od. By recruiting Reverse Transcriptase to the chromosome ends. O e. Recruitment of Helicase to the chromosome ends. QUESTION 7 Which sequence is the complement to sequence 5'-AGTTACTAAA-3'? O a. 5'-TCAATGATTT-3' O b.5'-GGCGGTACGT-3' Oc. 5'-TTTAGTAACT-3' O d. 5'-AGTTACTAAA-3 O e. 5'-AAATCATTGA-3'

QUESTION 6 The 'end replication problem' is an issue in eukaryotic cells with linear chromosomes. How do rapidly and continuously dividing cells, like stem cells, solve this problem? O a. Using the 5'-3' exonucleae activity of DNA polyermase. O b. None of the above. O c. Recruitment of Telomerase to the chromosome ends. Od. By recruiting Reverse Transcriptase to the chromosome ends. O e. Recruitment of Helicase to the chromosome ends. QUESTION 7 Which sequence is the complement to sequence 5'-AGTTACTAAA-3'? O a. 5'-TCAATGATTT-3' O b.5'-GGCGGTACGT-3' Oc. 5'-TTTAGTAACT-3' O d. 5'-AGTTACTAAA-3 O e. 5'-AAATCATTGA-3'

Name: 6 This doesn't not follow Chargaff's ruleQUESTION 6The 'end replicatio
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 6 This doesn't not follow Chargaff's ruleQUESTION 6The 'end replication problem' is an issue in eukaryotic cells with linear chromosomes. How do rapidly and continuously dividing cells,like stem cells, solve this problem?O a. Using the 5'-3' exonucle

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter17: Bacterial And Viral Genetics

Section: Chapter Questions

Problem 5TYK

See similar textbooks

Similar questions

Which of the following statements is NOT TRUE about genomic DNA replication? O A DNA replication begins at the origin of replication and proceeds bi-directionally O B. New nucleotides can be added by the DNA polymerase only to the 3 end of the growing strand O. Synthesis of new DNA is catalyzed by the enzymes called DNA polymerases OD. DNA replication is semi-conservative OE. DNA replication proceeds continuously on both parental DNA strands.
Which of the following statements about DNA is false? a. Phosphate is linked to the 5 and 3 carbons of adjacentdeoxyribose molecules. b. DNA is bidirectional in its synthesis. c. Each side of the helix is antiparallel to the other. d. The binding of adenine to thymine is through three hydrogenbonds. e. Avery identified DNA as the transforming factor in crossesbetween smooth and rough bacteria.
Which of the following statement(s) correctly describe(s) telomerase? Select all that apply. You may select multiple options. ✔Telomerase synthesizes DNA from an RNA template. O All of these options O Telomerase extends the lengths of telomeres of linear chromosomes in eukaryotes. O Telomerase unwinds the DNA duplex at telomeres. Telomerase serves as a primer for DNA synthesis at telomeres. O Telomerase has 5'-to-3' exonuclease activity.
Q.Sheltrin protein complex that has the following function: a.Protect telomerase from damage b.Protect telomere from damage c.Proteins as chaperones in autophagy d.Responsible in Proteostasis Q.Telomeres shorten by 50-200 bases with every cell division due to. a.End replication problem b.Cellular senescence c.mutations of Sheltrin proteins d.DNA Recombination
The following is a figure that depicts telomerase extending a telomere. -aaucccaauc ttag telomere The lagging strand template for DNA replication of this section of the chromosome is: a. Strand A Ob. Cannot be determined from the information given above O C. Not needed due to telomerase activity O d. Strand B O e. Strand C
QUESTION & Intercalating agents such as acridine orange function as mutagens to O A promote transitions O B. remove amine groups. O C. attach to purines causing distortions. O D. add ethyl or methyl groups. O E. fit between stacked bases and disrupt replication.
1. The diagram below depicts a DNA replication fork in a biological cell. The primer is shown by an arrow 5'-3'. A ATTATGTCTGGCCTTGAGTAAGGCTAATCACAT GCGTA GCAT Primer BTAATA TCATTC CGATT From the DNA diagram above, which ends (indicated as A, B, C & D) of the DNA template strand are the 5' and a. which are 3' ends? b. Which way is the direction of movement of the replication fork? Right or left of the figure. Which of the parental strands are the templates for leading (continuous) and lagging (discontinuous) strand synthesis?. Top or bottom strand. С. I d. Give the sequence of the five base long primer that is shown as an arrow in the diagram above 5' 3' Give the sequence of the next four bases that would be added to the growing end of the primer e. 5' 3'
Which of the following statements about the DNA replication is false? a. Synthesis of the new DNA strands is form 39 to 59 b.Synthesis of the new DNA strands is from 59 to 39 c. DNA Unwinds, primase adds RNA primer, DNA polymerases synthesize the new strand and remove the RNA primer d. Many initiation points exist in each eukaryotic chromosome. e. Okazaki fragments are synthesized in the opposite direction from the direction in which the replication for moves.
7. The beads on a string in the picture represent what in terms of DNA folding? eir functions. "Beads on a string" 0.05 um 2012 Pearscn Education Inc 300-nm looped domains b. Metaphase chromosome c. pearls d. Individual histones e. nuclosoOmes 8. A particular triplet of bases in the template strand of DNA is 5' ACT 3'. The corresponding codon for the MRNA transcribed is a. either UCA Or TCA, depending on wobble in the first base. b. 3'ACU 5'. c. 5' TCA 3'. d. 3' UGA 5'. e. 3' UCA 5'. Lenovo
Below is a study of a colony of cells, determine that some of these cells have a mutated DNA polymerase I that results in loss of function of this enzyme. - What will the effect of the mutation in DNA polymerase I be on DNA replication? Include leading and lagging strand - Will this mutation in DNA polymerase I have an impact on another step in DNA replication? Will DNA be replicatation be impacted? Are any enzymes involved?
Why are Gyrase inhibitors good antibiotics to use therapeutically? DNA Gyrase is required by prokaryotes, but not eukaryotes, to complete chromosomal replication so it's a good target to inhibit. O DNA Gyrase is required by eukaryotes, but not prokaryotes, to complete chromosomal replication so it's a good target to inhibit. It's impossible to develop resistance against Gyrase inhibitors so they are always effective. O DNA Gyrase is required by both prokaryotes and eukaryotes to complete chromosomal replication so it's a good target to inhibit.
Section B: True / False 1. The two sequences shown below are complementary to each other. T or F GTCGAC CAGCUG 2. Telomerase possesses RNA polymerase activity. T or F 3. Topoisomerase binds to DNA ahead of the replication fork. T or F snRNA is not transcribed during translation. T or F 5. Promoter is located in the intron of pre-mRNA. T or F Poly-A tail is added to RNA in bacteria. T or F Translation stops when Stop codon arrives E site in ribosome. T or F EF-G is used in translation termination. T or F 9. A subunit of hemoglobin carries more oxygen molecule than a myoglobin does. T or F 10. The formation of carbamate group in hemoglobin reduces its affinity to oxygen. T or F 4. 6. 7. 8.