Question 1: While examining a gene related to calcium ion channels in humans(CACNA1S) you discover a nearby region that likely codes for an miRNA associatedwith CACNA1S. What evidence would lead you to this conclusion? Stated anotherway, what would the discovered DNA region look like to convince you that youhad found an miRNA region associated with CACNA1S? (Hint: be mindful of the 3'-5' or 5'-3' direction in your answer)A. The template strand coding for the miRNA contains regions identical to thetemplate strand of the CACNA1s gene.B. The template strand coding for the miRNA contains regions identical to thecoding strand of the CACNA1s gene.C. The template strand coding for the miRNA contains regions antiparallel tothe template strand of the CACNA1s gene.D. The template strand coding for the miRNA contains regions antiparallel tothe coding strand of the CACNA1s gene.

D IS THE CORRECT ANSWER. AND EXPLANATION IS GIVEN BELOW .Explanation:

Answered: Question 1: While examining a gene…

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC 1. Identify the gene from which the querysequence originates (Name of gene) 2. Provide the FULLprotein sequence encoded by the gene. 3. Are different splice variants known for this gene? 4. What human disease has been connected to this gene? 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.
Question 4: Explain how a deletion mutation leading to a modification of the 3' untranslated region (UTR) on the CACNA1S mRNA could lead to hypokalemic periodic paralysis without changing the structure of the polypeptide formed? (Note this is not the known cause of hypoKPP, but it makes a good question)
The diagram below depicts an active transcription bubble after a short period of RNA synthesis during the transcription process of a prokaryotic gene. Redraw the diagram and label parts (i) to (v) on the diagram. Motivate your answers. (i) the template and the non-template strands; (ii) the orientation (direction) of both DNA strands and that of the newly synthesised RNA strand; (iii) the location of a possible promotor sequence; (iv) the location of a possible Shine-Dalgarno sequence; (v) the specific area of activity of a RNA polymerase.
Answer codon usage based on this description: You have isolated a new eukaryotic microorganism and want to determine the genetic code of its mitochondria. Here are the amino acids encoded after translation of two synthetic mRNAs using mitochondrial extracts from your eukaryote- in this experiment translation can start at any sequence position: RNA: Protein: Tyr-Met-Tyr-Met-Tyr-Met---- UAUAUAUAUAUAUAU--- UAAUAAUAAUAAUAA--- Asn-Asn-Asn-Asn-Asn---- Met-Met-Met-Met-Met---- Based on the results shown here, what can you conclude about the codons in this eukaryote? A. B. C. D. O A O C OD OB AUA Tyr Met Tyr Met UAU Met Tyr Met Tyr AAU Met Trp Asn UAA Asn Asn Asn Asn, STOP or Met Asn, STOP or Met
QUESTION 3 Indicate the statements that correctly apply to snRNA molecules: O Contains an anticodon O Contains a 5'UTR O Translated into protein O Transcribed in the 5 to 3' direction O Major component of ribosomes O Classified as "functional RNA" O Component of spliceosomes QUESTION 4 Indicate the statements that correctly apply to FRNA molecules: O Classified as "functional RNA" O Component of spliceosomes O Transcribed in the 5 to 3' direction O Translated into protein O Contains an anticodon O Major component of ribosomes O Contains a 5'UTR
Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human - globin gene (shown in the figure below (Links to an external site.)) into bacterial cells, hoping the cells will express it and synthesize functional - globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does -globin made by a eukaryotic cell. Explain why and give thoughts as to how to overcome this.
Question 28 Introns Protein-coding sequences that need to be excised B Non-coding regions that need to be excised Protein-coding sequences that form part of the mature MRNA Non-coding regions that form part of the mature MRNA Question 29 Anomers are A Either the open chain structure or the cyclic structure, established through mutarotation B) Either L or D Cyclic monosaccharides that differ only in the positions of substituents at carbon (alpha or beta) The fifteen other stereoisomers of glucose Question 30 The nuclear lamina A is the site of ribosomal RNA (FRNA) synthesis maintains the shape of the nucleus encloses the nucleus to separate it from the cytoplasm D) regulates the entry and exit of molecules from the nucleus
Question 2: You decide to test how the presence or absence of nucleosomes affects transcription using an in vitro transcription assay in which a DNA template featuring a promoter and single reporter gene is transcribed with the addition of specific factors in a test tube. You get robust transcription when you combine template DNA, RNA Polymerase, NTPs, and four general transcription factors - TFIIA, TFIIB, TFIID, and TFIIE. However, if you assemble the template onto purified nucleosomes and purify the chromatin template, then you don't get transcription even when all of the transcription components have been added. You decide to try a slightly different experiment where you first preincubate the template with all the transcription components except NTPs, then assemble the template onto nucleosomes and purify the chromatin template. Now when you add the transcription components and NTPs, transcription proceeds just as well as it does when using the naked DNA template (compare lanes 1…
Question Genes can be transcribed into mRNA, in the case of protein-coding genes, or into RNA, in the case of genes such as those that encode ribosomal or transfer RNAs. Define a gene. For the following characteristics, state whether they apply to (a) continuous, (b) simple, or (c) complex transcription units.i. Found in eukaryotesii. Contain intronsiii. Capable of making only a single protein from a given gene
Question 1: Define and give an example of the following: Codon, Start Codon, Anticodon, and Stop Codon. a) How is information from the DNA code copied and moved to the cytoplasm? b) What are the base pairing rules followed when one DNA strand is read and an mRNA made? Question 2: What eukaryotic sub-cellular structure is responsible for making proteins? a) Is this sub-cellular structure present in prokaryotes? b) What is the name of the enzyme responsible for making the mRNA? c) Is DNA always inside the nucleus of eukaryotic cells?
(d) Let's suppose that the exons encoding the binding site for the SARS-CoV-2 spike protein are widely spaced (the exons are far apart, the parts on the polypeptide are far apart-I made these up so if they coincide with your answers, it is by accident). As indicated below, exons 4.10 and 15 encode the parts of the protein (indicated by arrows) that interact with the spike protein. Exon 4 E10 E15 RNA (protein)_ N- Give TWO explanations as to how widely separated parts of a protein can interact with the spike protein. (I gave one in the class)
The following RNA sequence represents a small messenger which can be translated in a prokaryotic cell: 5'-ACGAAUGCACAGUAAAACUGGCUAGCGUAGGCUGA-3 Assume that the messenger RNA is translated in the cell, using the correct machinery and signals required for accurate protein synthesis. Using this RNA sequence and the Genetic Code Dictionary (see your textbook for the dictionary), solve the following problems A. Write the sequence of a protein that would be translated from this mRNA, using the appropriate stop and start signals, and indicating the correct termini of the protein product. B. Suppose that the underlined A in the sequence is changed to a U. Write the expected protein product of this mRNA.

SEE MORE QUESTIONS

Recommended textbooks for you

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Biology

ISBN:

9781259398629

Author:

McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter

Publisher:

Mcgraw Hill Education,

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Biology

ISBN:

9781259398629

Author:

McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter

Publisher:

Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)

Biology

ISBN:

9780815344322

Author:

Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter

Publisher:

W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology

Biology

ISBN:

9781260159363

Author:

Martin, Terry R., Prentice-craver, Cynthia

Publisher:

McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)

Biology

ISBN:

9781260231700

Author:

Sylvia S. Mader, Michael Windelspecht

Publisher:

McGraw Hill Education

SEE MORE TEXTBOOKS