Question 2: You decide to test how the presence or absence of nucleosomes affects transcription using an invitro transcription assay in which a DNA template featuring a promoter and single reporter gene is transcribedwith the addition of specific factors in a test tube. You get robust transcription when you combine templateDNA, RNA Polymerase, NTPs, and four general transcription factors - TFIIA, TFIIB, TFIID, and TFIIE.However, if you assemble the template onto purified nucleosomes and purify the chromatin template, then youdon't get transcription even when all of the transcription components have been added.You decide to try a slightly different experiment where you first preincubate the template with all thetranscription components except NTPs, then assemble the template onto nucleosomes and purify the chromatintemplate. Now when you add the transcription components and NTPs, transcription proceeds just as well as itdoes when using the naked DNA template (compare lanes 1 and 3). You conclude that one or more of thetranscription factors must bind to the template and keep the promoter accessible.To investigate this phenomena in more detail, you carry out two additional kinds of experiments. In one, youleave out individual transcription factors during the preincubation (lanes 4 – 8). In the second, you leave outindividual transcription factors during the transcription assay (lanes 9-13). Transcription templates werepreincubated with none, all, or all minus one of the transcription components. The transcription assay wascarried out with all, or all minus one of the transcription components. Use this information and the data below toanswer the questions.factors presentduring:preincubationtranscriptiontranscript →→→→nakedDNA0 0 all -A -B -D -E -Pol all all all all allall all all all all all all all -A -B -D -E -Polrrrrr1 234DNA assembled into chromatin-5678910 11 12 13A) Which of the transcription components must be present during the preincubation to keep the template activeduring chromatin assembly? Explain your answer.B) Which of the transcription components form a complex with the template that is stable to chromatinformation and subsequent chromatin purification? Explain your answer.C) Which of the transcription components must be added during the assay in order to produce a transcript?Explain your answer.

Name: Question 2: You decide to test how the presence or absence of nucleos
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Question 2: You decide to test how the presence or absence of nucleosomes affects transcription using an invitro transcription assay in which a DNA template featuring a promoter and single reporter gene is transcribedwith the addition of specific fa

The term "chromatin" describes the DNA and protein mixture that makes up the chromosomes found in…

Science

Biology

A) Which of the transcription components must be present during the preincubation to keep the template active during chromatin assembly? Explain your answer. B) Which of the transcription components form a complex with the template that is stable to chromatin formation and subsequent chromatin purification? Explain your answer. C) Which of the transcription components must be added during the assay in order to produce a transcript? Explain your answer.

A) Which of the transcription components must be present during the preincubation to keep the template active during chromatin assembly? Explain your answer. B) Which of the transcription components form a complex with the template that is stable to chromatin formation and subsequent chromatin purification? Explain your answer. C) Which of the transcription components must be added during the assay in order to produce a transcript? Explain your answer.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 13QP

See similar textbooks

Similar questions

Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription? Group of answer choices 1.Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds. 2.Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds. 3.Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination. 4.Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination.
What is meant by the term chromatin remodeling? Describe the importance of this process to transcription.
Suppose you have a 1-kb segment of cloned DNA that is suspected to contain a eukaryotic promoter including a TATA box, a CAT box, and an upstream GC-rich sequence. The clone also contains a gene whose transcript is readily detectable. Your laboratory supervisor asks you to outline an experiment. (1) determine if eukaryotic transcription factors (TF) bind to the fragment and, if so, (2) identify where on the fragment the transcription factors bind. All necessary reagents, equipment, and experimental know-how are available in the laboratory. Complete the outline of an experiment, which determines if eukaryotic transcription factors (TF) bind to the fragment. Assume all necessary reagents, equipment, and experimental how are available in the laboratory. Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Not all terms will be used. For the band shift assay, two samples of the DNA fragment are analyzed by agarose gel electrophoresis: one sample is…
The diagram below depicts an active transcription bubble after a short period of RNA synthesis during the transcription process of a prokaryotic gene. Redraw the diagram and label parts (i) to (v) on the diagram. Motivate your answers. (i) the template and the non-template strands; (ii) the orientation (direction) of both DNA strands and that of the newly synthesised RNA strand; (iii) the location of a possible promotor sequence; (iv) the location of a possible Shine-Dalgarno sequence; (v) the specific area of activity of a RNA polymerase.
Question:- Define the transcription unit. How does it differ from the gene? Describe how you would determine the 5' and 3' ends of a transcription unit in a genome browser.
The chart below is a position specific scoring matrix (PSSM, a logarithmic transformed matrix) for a transcription factor binding site. (1). Evaluate a sequence “GACATTCA” to find out which segment of the sequence fits the binding site best. (2) What is the max score that a sequence can have with this PSSM? (3) What is the minimum score a sequence can have with this PSSM?
The following double-stranded DNA sequence is part of a hypothetical yeast genome which contains a very small gene. Transcription starts at the Transcription Start Site (TSS), proceeds in the direction of the arrow and stops at the end of the Transcription Terminator (green box). 5' 3' TSS CTATAAAAATGCCATGCATTATCTAGATAGTAGGCTCTGAGAAATTTATCTCACT | | | | | | | | | | GATATTTTTACGGTACGTAATAGATCTATCATCCGAGACTCTTTAAATAGAGTGA - 5' PROMOTER TERMINATOR 3' a) Which strand (top or bottom) is the template strand? Explain why. b) What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends. c) What is the sequence of the protein produced from the mRNA? d) If a mutation (an insertion) were found where a T/A (top/bottom) base pair were added immediately after the T/A base pair shown in red, what would be the sequence of the mRNA? What would be the sequence of the protein?
QUESTION 2 If you made a change in the DNA of a promoter sequence that inactivates the promoter, what would happen at the RNA level? O The DNA helicase would not be able to recognize and bind the DNA, so the RNA would not be made The mutation of the DNA would be carried through to the RNA sequence The RNA polymerase would not be able to recognize and bind the DNA, so no RNA would be made Nothing, because the RNA would be made as usual
INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: UGA, UAG and UCG are termination codon STAMENT 2: Missense mutation is a type of mutation that changes the coded amino acid ANSWER: STAMENT 1: Binding of RNA primer to the DNA is the first step in the transcription cycle STAMENT 2: Translation refers to the synthesis of proteins using the information contained in mRNA ANSWER: STAMENT 1: The carbon number in ribose where guanine is connected is 1 STAMENT 2: The other name for unprocessed eukaryotic RNA is raw nuclear RNA ANSWER:
5 5 S 6 5 5 5 6 U 6 U 6 5:14 PM | 0.2KB/s HHHHH R R U RUUR ARU AP AP R U U R R AP R R R AP MOLECULAR...GENETICS. Describe gene regulation at transcription level. Explain the role of antsense RNA in control mechanism. Describe translational control mechanisms. Describe common DNA damages. Distinguish excision and mismatch repair. Describe the role of recA protein in recombination repair Elaborate on SOS repair mechanism. Define thymine dimer. How are they formed and repaired? Describe the molecular basis of mutation. 11 Leu+ Met+ Arg+ Write a detailed note on spontaneous mutation. Explain about mutant detection methods. Define reverse mutation. Describe the mechanism underlying Intragenic and intergenic suppressor mutations Describe the transposition mechanisms. 13 Vo LTE UNIT IV Time (Min) Describe the process of generalised transformation occurring in bacterial chromosome and plasmid. Elaborate on molecular mechanism and significance of transformation 22 Describe the process of…
Choose the best answer. transcriptional bubble in prokaryotes is produced by… Group of answer choices TFIID TFIIH Sigma factor and RNA polymerase TATA-Binding Protein Which polymerase transcribes the coding sequences of mRNAs in eukaryotes? Group of answer choices Poly(A) Polymerase RNA Polymerase I RNA Polymerase II RNA Polymerase III What role does TFIID play in transcription? Group of answer choices TFIID binds to the terminator sequence to stop transcription. TFIID acts as a regulatory kinase and helicase. TFIID prevents RNA polymerase II from associating with non-promoter sequences. TFIID binds to the INR and DPE sequences to distort the promoter sequences.
39/ 50 Which of these is the function of a poly (A) signal sequence? A. It adds the poly (A) tail to the 3' end of the mRNA B It codes for a sequence in eukaryotic transcripts that signals termination of transcription-10-35 nucleotides away C. It allows the 3' end of the mRNA to attach to the ribosome DR is a sequence that codes for the hydrolysis of the RNA polymerase It adds a 7-methylguanosine cap to the 3' end of the mRNA