Preimplantation genetic testing for aneuploidy (PGT-A) is meant to identify and discard embryos with chromosome number abnormalities. However, it has not been proven to be valuable in human IVF. What do you think PGT-A is not working as expected
Q: 1. Give two SPECIFIC examples of when, where, and why temperature and pH are important to the…
A: Enzymes are biological catalysts that speed up the rate of chemical reactions. Enzymes are highly…
Q: how did the K-Pg (aka Cretaceous–Paleogene) mass extinction gave new ecological opportunities to…
A: The K-Pg mass extinction, also known as the Cretaceous-Paleogene extinction or Cretaceous-Tertiary…
Q: Experiment Mouse injected with type S Mouse injected with type R Mouse injected with dead type S…
A: According to our guideline we can answer only the first question (up to there subparts). All the…
Q: draw a curve of the rate of Fructose 1, 6-bisphosphate produced vs. [ATP].
A: Phosphofructokinase or PFK1 catalyzes the reaction between fructose-6-phosphate and ATP to produce…
Q: a phylogenetic tree includes 10 species, each of which is a terminal node, how many clades does it…
A: phylogenetic tree is a branching diagram which shows the evolutionary relationships among biological…
Q: Select the best answer or answers from the choices given: The blood volume in an adult averages…
A: The amount of blood in the human body is mostly 7 percent of our body weight. The amount of blood…
Q: Which basal transcription factor contains a subunit that causes local distortion in DNA so that…
A: ANSWER) The distortion in the DNA during transcription is produced by the one of the various factors…
Q: DNA polymerases are processive, which means that they remain tightly associated with the template…
A: Introduction DNA acts as a genetic material in our body. DNA is a double stranded and self…
Q: 3- Explain the RAAS mechanism.?
A: The renin-angiotensin-aldosterone system (RAAS), also known as the renin-angiotensin-system (RAS),…
Q: In a human population of Korfu16% of individuals are Rh-negative. Assuming that this population is…
A: According to Hardy-Weinberg equilibrium the allele and genotype frequences will remain same…
Q: plant animal bacterial fungal This is a cell.
A: Introduction The fundamental building block of life, a cell is what allows creatures to live and…
Q: Based on what you know on how ultrasound imaging works, what do you think will NOT look like a black…
A: Diagnostic ultrasound, also called sonography or diagnostic medical sonography, is an imaging method…
Q: Prokaryotes were the major life form on Earth for about three Decades Million years Centuries…
A: An entity which is alive, like plants and animals, is referred to as a life form. Over five billion…
Q: Using meiosis. Explain why Drosophila progeny remain diploid 2n=8?
A: Meiosis can be called a form of cell division that occurs during sexual reproduction and lowers the…
Q: Describe the principle of a banding technique that can be used to help visualise chromosomes and…
A: Banding pattern enables to view some specific gene rich frequences and chromosomes that are…
Q: Assuming mitosis is divided into prophase, prometaphase, metaphase, anaphase, and telophase,…
A: Mitosis is a type of cell division resulting in the formation of two daughter cells that are similar…
Q: CGA CUA CCA UCA ACA GUA GGA GGC CCGC AUA CUC CCC UCC ACC GUC 3 CGG GAC AAC UGC GAA CAA GGG CAC AUC…
A: The process of synthesis of proteins with the help of messenger RNA is called translation. Proteins…
Q: 345 bison is wandering and grazing in an area where there is an old bridge across a river leading to…
A: 1 2 and 3 Bottle neck affect is an extreme example of genetic dtift that happens when the size of a…
Q: DNA structure and its 3 chemical components
A: DNA is the genetic material in living organisms that contain genes which determine the…
Q: Why are people with balanced chromosomal translocations phenotypically normal? Do they suffer from…
A: A balanced or chromosomal translocation is a condition in which part of a chromosome has broken off…
Q: Which of the following enzymes can decatenate replicated bacterial chromosomes? please explain the…
A: Bacterial chromosome is a circular and covalently closed one. Various enzymes are involved in the…
Q: Describe the pharmaceutical uses of at least four (4) different types of alkaloidal drugs, including…
A: Introduction; A group of naturally occurring organic nitrogen-containing substances known as…
Q: How is a olive tree utilized today?
A: Olive trees are Eastern Mediterranean evergreen trees/shrubs belonging to Family Oleaceae. Their…
Q: Place the following steps of DNA replication in order: Origin melting RNA priming Helicase loading…
A: DNA replication is the process by which the genetic material of a cell is duplicated before the cell…
Q: What happens to a cell in the absence of meiotic recombination?
A: Meiosis is a kind of cell division involving the production of 4 daughter cells having half number…
Q: Explain the Methods and standards for disposal of biomedical waste
A: Any garbage that contains infectious (or possibly contagious) components is referred to as…
Q: you know that 1.1OU=1um. you have an organism that measures at 12 O.U at 10x. How long is your…
A: The capacity of a microscope to create an image of an object at a scale bigger (or even smaller)…
Q: Most laboratory strains of E. coli contain site-specific DNA methylases. The methylase encoded by…
A: DAM and DCM methylases are methylases which methylate certain portions of the genome. The…
Q: Discuss salient features of protozoan
A: Protozoans are the tiny, unicellular and microscopic organisms that contains complex structures with…
Q: What is the best anticoagulant for blood? Explain
A:
Q: Explain translocation, deletions and duplications
A: Chromosome is organized structure of DNA and proteins present in the nucleus of eukaryotic cell.Each…
Q: SIGNALS AND TARGETS. Listed below are sample polypeptides/proteins with their signal…
A: Signal recognisation sequence are the sequence that are responsible for transporting the particular…
Q: Which micronutrient can be destroyed by chelating agents? O a. selenium Ob.phosphorous Oc. iron…
A: An organic chemical complex known as a chelate is one in which the metal component of the molecule…
Q: Our lacrimal glands secret tears through the process glands secret saliva through the process O…
A: Endocytosis refers to a cellular process in which intake of substances is done by the cell. In this…
Q: Sickle cell anemia is inherited as an autosomal recessive condition. It also exhibits incomplete…
A: Sickle cell anemia (SCA) is a genetic disorder that occurs when an individual has two homozygous…
Q: ►Diagram and label the relationship between metabolism, enzyme, activation energy, substrate and…
A: An enzyme is a substance that speeds up or controls the pace of reaction without changing itself.…
Q: Where did the olive tree originally come from and where can we find it now?
A: Olive trees exhibit a clear predilection for calcareous soils, thriving best in coastal climates and…
Q: 26-29. Four of the nitrogenous bases that constitute part of a DNA or RNA molecule are (NO…
A: The most significant biological macromolecule is called nucleic acid, which consists of nitrogenous…
Q: How can a horse sustain eating plant materials even if its stomach is not capable of dugesting…
A: The digestive system of the horse is among the most intricate and, probably, the most challenging…
Q: What do you understand by cis & trans regulations? Describe.
A: Cis and Trans are the regulatory element which play a important role in gene expression.Promotres,…
Q: Solution: III. For numbers 11 to 15, explain your answers in 1-2 sentences for the following…
A: Meiosis is divided into meiosis I and meiosis II. Metaphase I is associated with meiosis I while…
Q: Describe the relationship between non -muscle myosin ,actin and growth cone extension.
A: When cells receive and react to signals from other cells to support various bodily activities, such…
Q: 1. What 3 different ways ATP is used in skeletal muscle contraction? 2. What role is played by…
A: A muscle contraction (also known as a muscle twitch or simply twitch) occurs when a muscle cell…
Q: 13. Which of these statements concerning the symport of glucose into cells is true? Understand a.…
A: Molecules or ions need to be transported along their membranes the maintain their concentrations…
Q: 3. What is the Simpson's Diversity index for the followin What is the Species Richness value for the…
A:
Q: Discuss the human life cycle and the purpose of meiosis.
A: The family Hominidae and the genus Homo include the culture species known as humans. Humans resemble…
Q: How could a host cell use myosin to arrange actin such that a virus couldn't enter the cell?
A: If a group of bacteria or virus invades host cells like gut epithelium cells by stimulating the…
Q: Explain why the precise length of the template DNA sequence does not become amplified until the…
A: There is always one set of original long-template DNA molecules which is never fully duplicated.
Q: Explain why species that occur early in succession would have a large number of small-wind driven…
A: The periodic shift in community structure caused by species colonization and replacement is referred…
Q: True or False: (T/F) Physical forces acting on the thorax and wing hinge during flight are detected…
A: Insects have flight muscles attached directly to their wings. Flight muscles move the wings…
Preimplantation genetic testing for aneuploidy (PGT-A) is meant to identify and discard embryos with chromosome number abnormalities. However, it has not been proven to be valuable in human IVF. What do you think PGT-A is not working as expected
Step by step
Solved in 2 steps
- 1) Do you agree or disagree with this statement? Transposons can cause genomic rearrangements or genomic expansion compared to microsats, which are only associated with genomic expansion. Explain your response. 2) Do you agree or disagree with this statement? Since bone is a non-living structure, it would not be useful for genomic profiling. Explain.What is ICSI? Briefly describe one of the ethical concerns of using ICSI to treat infertility in a couple where the male has an AZF deletion mutation.A research group collaborating with the hospital extracted DNA from the peripheral blood leucocytes of the patient V.1, her sister V.2, her mother IV.1 and her father IV.2 with consent and ethical approval for experimental work involving human tissues. These specimens were used for sequencing studies to screen for causative variants in amyloid precursor protein (APP), presenilin-1 (PSEN1) and presenlin-2 (PSEN-2) genes. The outcome is shown in Fig. 2 below. APP IV.1 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG V.2 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG -Y--G--G--C--G--G--N--R--N--N--F--D--T--E--E--Y--C--M--A--V- Amino Acid IV.2 961 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 Amino Acid -YGGCGGNRN NFD TEEY C-M-A-V-340 V.1 961 PSEN-1 IV.1 361 V.2 361 Amino Acid PSEN-2 1020 1020 340 CATACCGACACTCTCCCCCACACACCCCTGCACTCAATTCTCAATCCTCCCATCATCATC 420…
- In contrast with the genomic manipulations of animals and plants described in this chapter, human genetherapy is directed specifically at altering the genomes of somatic cells rather than germ-line cells.Why couldn’t or wouldn’t medical scientists try to alter the genome of human germ-line cells?A couple with a child affected with DBA undergoes in vitro fertilization (IVF) and genetic testing of the resulting embryos to ensure that the embryos will not have DBA. However, they also want the embryos screened to ensure that the one implanted can serve as a suitable donor for their existing child. Their plan is to have stem cells from the umbilical cord of the new baby transplanted to their existing child with DBA, thereby curing the condition. What are the ethical pros and cons of this situation?Not all inherited traits are determined by nuclear genes (i.e., genes located in the cell nucleus) that are expressed during the life of an individual. In particular, maternal effect genes and mitochondrial DNA are notable exceptions. With these ideas in mind, let’s consider the cloning of a sheep (e.g., Dolly). A. With regard to maternal effect genes, is the phenotype of such a cloned animal determined by the animal that donated the enucleatedegg or by the animal that donated the somatic cell nucleus? Explain.
- List three clinical indications for chromosome and/or genome analysis and why the process might be important for each indication.discuss the engineered embryronic stem cell method of obtaining gain of function transgenic miceWhile multiple animal studies have found that food dyes are not associated with no genotoxic effect effects, transient DNA damages occur in the colon of mice treated by amaranth and tartrazine dyes. TRUE OR FALSE Ultra-pasteurized organic milk can last a few weeks (longer expiration date) longer than the week or two that pasteurized conventional milks are labeled with, because that organic milk does not have the additives that conventional milk may have. TRUE or FALSE Red 3 has replaced Red 40 in most foods, because Red 40 could increase the risk of thyroid tumors as shown in some animal studies. TRUE OR FALSE Since the introduction of many pest-resistant GM crops, the usage of glyphosate has declined on conventional agriculture products. TRUE OR FALSE
- True or False: 1. The 6X HIS tag is required for a eukaryotic protein to be expressed in E. coli 2. BAC vectors are an appropriate choice for cloning cDNAs 3. Cluster analysis of micro-array data groups together mRNAs of similar sequence 4. In genomic DNA, on average EcoR1 restriction sites are more common than Mse1 restriction sites 5. Tags such as HA that are fused to proteins always compromise their function.How can telomerase-related aging be addressed therapeutically?Mouse models for human genetic diseases are potentially powerful tools to help geneticists understand thecause of the aberrant phenotypes and develop newtherapeutic measures. However, such mice are not always as useful to investigators as it might seem at firstglance. Suppose that you have a mouse knockoutmodel for a human disease caused by homozygosityfor a null allele of a gene. Discuss how the followingsituations might complicate investigations of the human disease based on this mouse model.a. Mice have a shorter life span than humans.b. Mice homozygous for certain knockout mutationsdie in utero.c. Mouse genomes may have additional copies of thegene whose mutation causes the disease in humans.d. Mice from different inbred lines homozygous forthe same gene knockout vary in the penetrance andexpressivity of the phenotype.e. Manipulations to create the knockout mouse, suchas the presence of a drug resistance gene that allowsthe selection of cells containing the knockout (seeFig. 18.9),…