Most laboratory strains of E. coli contain site-specific DNA methylases. The methylase encoded by the dam gene (Dam methylase) transfers a methyl group from S-adenosylmethionine (SAM) to the N6 position of the adenine residues in the sequence GATC. The Dcm methylase (encoded by the dcm gene) methylates the internal cytosine residues in the sequences CCAGG and CCTGG at the C5 position. The E. coli strain used in this experiment is mutated so Dcm and Dam methylases are not functional. What is the advantage of using dcm or dam mutants when the E. coli will be a host to recombinant DNA? HINT – If the E. coli methylates the DNA in these cells, then how would this affect the activity of restriction endonucleases

Most laboratory strains of E. coli contain site-specific DNA methylases. The methylase encoded by the dam gene (Dam methylase) transfers a methyl group from S-adenosylmethionine (SAM) to the N6 position of the adenine residues in the sequence GATC. The Dcm methylase (encoded by the dcm gene) methylates the internal cytosine residues in the sequences CCAGG and CCTGG at the C5 position. The E. coli strain used in this experiment is mutated so Dcm and Dam methylases are not functional. What is the advantage of using dcm or dam mutants when the E. coli will be a host to recombinant DNA? HINT – If the E. coli methylates the DNA in these cells, then how would this affect the activity of restriction endonucleases

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Consider the structure of Cro repressor protein from bacteriophage lambda E. It is a DNA binding protein, and like many sequence- specific DNA binding proteins, it must function as a homodimer Ex. Notice the mutual docking of a phenylalanine residue from each subunit into a hydrophobic pocket of the partner subunit. These hydrophobic interactions are required for dimerization. The noncovalent interactions highlighted in yellow are also required for dimerization. These interactions represent examples of: Osecondary structure O tertiary structure O quaternary structure O secondary AND quaternary structure Ⓒ tertiary AND quaternary structure
Some molecules found in foods are known to be capable ofdriving DNA methylation or DNA demethylation. For example,folic acid (a vitamin), vitamin B12, and choline are thought toincrease methylation. Based on this consideration, why wouldit be important to avoid eating excessive quantities of suchmolecules (while being certain to eat sufficient quantities forhealth)?
In E. coli, a methyltransferase enzyme encoded by the dam generecognizes the sequence 5′–GATC–3′ and attaches a methyl groupto the nitrogen at position 6 of adenine. E. coli strains that have thedam gene deleted are known to have a higher spontaneous mutationrate than normal strains. Explain why.
The sequences of DNA bases below represent parts of the genes responsible for the production of one type of protein, an enzyme, produced by Botana curus and Species X, Y, and Z Under each DNA sequence, write the complementary messenger RNA base sequences that each of these gene fragments would produce. Note: Unlike during DNA replication, in the production of messenger RNA, the DNA base “A” specifies the RNA base “U.”. Use the universal genetic code table provided (see Universal Code attachment) to translate the messenger RNA base sequences into sequences of amino acids in the protein produced by each species. Write the sequences of amino acids under the messenger RNA sequences.
Within living cells, many different proteins play importantfunctional roles by binding to DNA. Some proteins bind to DNA butnot in a sequence-specific manner. For example, histones are proteinsimportant in the formation of chromosome structure. The positivelycharged histone proteins bind to the negatively charged phosphategroups in DNA. In addition, several other proteins interact with DNAbut do not require a specific nucleotide sequence to carry out theirfunction. For example, DNA polymerase, which catalyzes thesynthesis of new DNA strands, does not bind to DNA in a sequencedependent manner. By comparison, many other proteins do interact with nucleic acids in a sequence-dependent fashion. This means that a specific sequence of bases can provide a structure that isrecognized by a particular protein.Someexamples include transcription factors that affect the rate oftranscription and proteins that bind to origins of replication inbacteria.What information do you know based onthe question…
Within living cells, many different proteins play importantfunctional roles by binding to DNA. Some proteins bind to DNA butnot in a sequence-specific manner. For example, histones are proteinsimportant in the formation of chromosome structure. The positivelycharged histone proteins bind to the negatively charged phosphategroups in DNA. In addition, several other proteins interact with DNAbut do not require a specific nucleotide sequence to carry out theirfunction. For example, DNA polymerase, which catalyzes thesynthesis of new DNA strands, does not bind to DNA in a sequencedependentmanner. By comparison, many other proteins do interactwith nucleic acids in a sequence-dependent fashion. This means that a specific sequence of bases can provide a structure that isrecognized by a particular protein.Someexamples include transcription factors that affect the rate oftranscription and proteins that bind to origins of replication inbacteria.What topic in genetics does this question address?
Within living cells, many different proteins play importantfunctional roles by binding to DNA. Some proteins bind to DNA butnot in a sequence-specific manner. For example, histones are proteinsimportant in the formation of chromosome structure. The positivelycharged histone proteins bind to the negatively charged phosphategroups in DNA. In addition, several other proteins interact with DNAbut do not require a specific nucleotide sequence to carry out theirfunction. For example, DNA polymerase, which catalyzes thesynthesis of new DNA strands, does not bind to DNA in a sequencedependentmanner. By comparison, many other proteins do interactwith nucleic acids in a sequence-dependent fashion. This means thata specific sequence of bases can provide a structure that isrecognized by a particular protein.Someexamples include transcription factors that affect the rate oftranscription and proteins that bind to origins of replication inbacteria. With regard to the three-dimensional structure of…
Oxidation of DNA bases is mutagenic. An oxidized form of guanine,8-oxoguanine, can base-pair with adenine, leading to errors in DNAreplication. A gene called mutT acts to minimize the tendency of A-oxoGbase pairs to form. The mutT gene product was purified and shown to be anenzyme. Speculate on the reaction catalyzed by this enzyme.
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
Eukaryotes modify mRNA with an m7G cap: an N7-methylated guanosine linked via a 5′ to 5′ triphosphate linkage, and by methylation at the 2'-hydroxyl of the penultimate nucleoside. What cofactors involved in the capping reaction? Show their structure and properties
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.
Some RNA molecules are covalently modifi ed by methylation at the N6 position in adenosine residues. Draw the structure of the modified nucleoside.