Q: 9. Which of the following statements about meiosis is correct? A. Gametes are haploid cells…
A: Meiosis is a type of cell division in which the parent cell is divided into four daughter cells such…
Q: A patient most likely presents with chronic myeloid leukemia (CML) and you have a fullI blood cell…
A: Chronic myeloid leukemia (CML) is also known as 'chronic myelogenous leukemia', is an uncommon type…
Q: State the three main functions of the digestive system.
A: Digestion involves two aspects- mechanical digestion and chemical digestion. Mechanical digestion is…
Q: In Mendel’s terminology, a “true-breeding” variety of a particular plant: a. Has a homozygous…
A: Introduction Breeding is the sexual reproduction of animals or plants that results in progeny. It…
Q: Which of the following is not true about the premise of a dose/response relationship? A There is a…
A: ANSWER;- LD50 is the inverse square of the dose Explain;- LD means "Lethal Dose". LD50 is how much a…
Q: Case fatality rate. Based table 1, what conclusion can you draw about the risk of acquiring…
A: Tuberculosis (TB) is caused by bacteria Mycobacterium tuberculosis that most affect the lungs.
Q: Describe the step-by-step procedure of passage cells.
A: Cell passaging or splitting is a technique that enables an individual to keep cells alive and…
Q: Give meanings for the following abbreviation: 1. OU – Both Eyes 2. VA - 3. OD - 4. OS - 5. VF - 6.…
A: Medical terminology is language used to describe anatomical structures, procedures, conditions,…
Q: Explain whether the micrograph shown in the question is a stem or a root that belongs to eudicot or…
A: Dicotyledons, or simply dicot, are plants with two cotyledons or embryonic leaves in their seeds.…
Q: The pituitary gland is often referred to as the master gland. Set aside the fact that this term is…
A: The pituitary gland is a small gland near lower area of the brain that is about the size of a…
Q: In sulfur photosynthetic bacteria what is the molecule that donates hydrogen for photosynthesis?
A: Introduction - Sulfur-oxidizing bacteria are prevalent. Thiobacillus thiooxidans is a…
Q: By looking at the picture above, describe the events that take place during fertilization up to the…
A: Fertilisation is q process of fusion of male and female games resulting in the formation of a…
Q: Please answer asap and in short Outline and summarise each of the four stages of qualification in…
A: Although a scale-down bioreactor can have multiple applications, our focus here is on appropriate…
Q: Describe 5 examples of biological processes that can cause DNA supercoil?
A: Supercoiling This process takes place to relieve the helical stress in the molecule through twisting…
Q: Which of the following post-translational modification(s) anchor(s) the protein to the biological…
A: By covalently adding functional groups or proteins, proteolytic fragmentation of regulatory…
Q: chymotrypsin
A: Chymotrpsin: It is a digestive enzyme which breaks down polypeptides. It consists of a catalytic…
Q: The following statements are correct except* a. Assimilates are transported from areas of supply to…
A: Food, primarily sucrose ( assimilate) is transported by the vascular tissue of phloem from a source…
Q: What is the comparison between acrylic and chrome cobalt
A: Dentures are the frames that hold one or more artificial teeth together. These are the prosthetic…
Q: 6. Draw changes in potential in the wet bone during cyclic compression. 7. Can the flow potential be…
A: There are few important points that should be kept in mind : As we know that bone tissue consist of…
Q: Discuss the THREE (3) main stages crucial to microbial leaching of copper from a low-grade ore,…
A: Bioleaching involes microorganisms .Main copper minerals include sulfides, (CuFeS2) chalcopyrite,…
Q: What is the PAR receptor?
A: In biology, receptors are chemical structures made up of proteins that aid in signal transmission by…
Q: ➢ Is the tripartite body plan of phoronids advantageous for them? Why or why not? ➢ Why is the…
A: Phoronids Phoronids are also known as horseworms. These are small marine organisms of the animal…
Q: In ruminants, what is the function of their gut microbes? O Make vitamin D O Digest cellulose O Move…
A: Cellulose is an organic compound or structural polysaccharide of plants and algae. It provides…
Q: The genes encoding the proteins involved in photosynthetis are activated and their mRNAs are made…
A: The transcription is the process of RNA production from DNA template that occurs will in the nucleus…
Q: What do you think will happen if human cells becomes motile?
A:
Q: Which one of the following is ordinarily not an air pollutant ? (A) CO2 (B) CO (C) SO2 (D)…
A: Air pollution is the contamination of air due to the presence of chemical, physical and biological…
Q: What is an introduction to immunology and immunopathology?
A: The immune system is comprised of various cellular and humoral elements such as T, B-lymphocytes,…
Q: How does the presence of gill slits in all vertebrate embryos support the theory of descent from a…
A: Gill slits are any of the openings or clefts between the gill arches in aquatic vertebrates that…
Q: ECOR1 cuts Plasmid T into 3 pieces. Feeling grumpy at your professor (☹), you decide to take a…
A: Introduction A plasmid is a little extrachromosomal DNA molecule that can replicate independently of…
Q: What would be the consequences to the outcome of meiosis if SPO11 is absent? Explain your reason.
A: Meiosis is a type of cell division that produces four gamete cells by halving the number of…
Q: The anatomy of Pinus needle reflects the features of a- (A) Mesophyte (B) Xerophyte (C) Hydrophyte…
A: Introduction - Pine needles spiral around the stem in a spiral pattern. Each year, as a pine tree…
Q: When a certain body arna manitest an typeromia, increased capilary fitration and sweoling, mis…
A: Introduction Hyperemia is a condition in which there is an excess of blood in the vessels of a body…
Q: ACTIVITY 12 - CARBOHYDRATES As you watch the videos, take notes about what you are learning about…
A: Introduction Sugar molecules are carbohydrate molecules. Carbohydrates are one of three main…
Q: The morphological nature of rhizophore of Selaginella is- (A) Root like (B) Stem like (C) Both root…
A: Introduction - Rhizophore: tufts of adventitious roots near the tip of club mosses of the genus…
Q: Briefly discuss how sickle cell mutation affects the protein.
A: Normal RBC ( Red blood cells are ) are biconcave shaped , and comprises of pigment protein…
Q: General characteristics of protozoans Internal and external structures Feeding…
A: Protozoa are unicellular organisms. They range in size or shape from an amoeba, which could also…
Q: Which is common between aerobic respiration and anaerobic respiration ? (A) Similar substrate (B)…
A: Introduction - Respiration can be divided into two categories: Respiration that occurs in the…
Q: 1. Briefly discuss the folowing; (a) sources of microorganisms in low-heat-processed meat products;…
A: The non-vegetarian food is highly nutritious in nature and has a very high amount of protein…
Q: 10. A fly gene Faf is required for eye development. The human genome has a homologous gene called…
A: Introduction A homologous gene (or homolog) is a gene passed down from a common ancestor in two…
Q: 7) This refers to the pattern being followed by the arrangement of an animal's body parts. 8) This…
A: The organisms are classified into three categories based on symmetry - Assymetric Radially…
Q: MSA/mannitol salt agar plate is selective because: O it allows only gram positive bacteria to grow O…
A: Mannitol salt agar(MSA) It is a selective medium used for the isolation, enumeration and…
Q: The reason why the eudicot trees tend to be wider at the base than at the top.
A: In eudicots, the endosperm is included within the cotyledons and is not separated. The two…
Q: Medium/test Used Negative result Indicators, key regents, or key ingredients Positive result…
A: Dear student as per Bartleby policy i can solve first three parts only. Please post the remaining…
Q: List and describe the 6 stages of phagocytosis.
A: Introduction :- Phagocytosis is a cellular process that involves the ingestion and elimination of…
Q: a. Carbon Cycle i. Producers ii. Consumers iii. Decomposers iv. Methanogenesis
A: Carbon cycle is the biogeochemical cycle by which carbon is exchanged among biosphere, pedosphere,…
Q: How was the first natural antibiotic discovered? (To answer this question, identify the antibiotic,…
A: Antibiotics are antimicrobial substances that are active against microorganisms. It is the most…
Q: . Why doesn't having a gene variant associated with a particular illness or disorder guarantee a…
A: Genes are DNA structures found in chromosomes. The structure of our genes governs how our bodies…
Q: answer 1,2,3,4,5,6,7 and 8. 1. Diphyllobothrium latum 2. Taenia saginata 3. Taenia solium 4.…
A: Answered 1234
Q: How is cystic fibrosis inherited
A: Cystic fibrosis is a disease that affects the lungs and organs of the digestive tract due to…
Q: The is the foundation of a medical term The comes at the end of a medical term The is attached to…
A:
Step by step
Solved in 2 steps
- Cynt Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: $-ATGTATATCTCCAGTTAG-3" It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. mutant DNA 5- ATGTATCATCTCCAGTTAG-3' S-ATGTATATCTCCAGTTAG-3 5- ATGTATATATCCAGTTAG-3' type of mutation (check all that apply) insertion deletion point silent noisy insertion O deletion point silent noisy insertion O deletion point silent Onoisy X GSome events that may occus during transcription 1. RNA polymerases detach 2. DNA polymerases detach 3. DNA polymerases proofread 4. RNA double helix is unzipped 5. DNA double helix is unzipped 6. DNA double helix forms again 7. Free nucleotides in the nucleus bond to exposed nucleotides of the senes strand 8. Free nucleotides in the nucleas bond to eposed nucleotides of the sense antisense strand 9. RNA ligase fuses the Okazaki fragments 10. RNA polmerase binds to the sense strand 11. DNA polymerase binds to the sense strand 12. RNA polymerase binds to the antisense strand 13. DNA polymerase binds to the antisenes strand List in sequences the events involoved in DNA transcription numbers above are ______, _______, ________, ______, and ________Alternative splicing Template strand S F yIGUide1,mq00:c-00: Replisome Transforming principle Origin of replication (or)eleb al msxS ain Coding strand Transcription factors Leading strand Single nucleotide polymorphism Okazaki fragment Telomerase M Nucleoside RNA Polymerase I RNA Polymerase II RNA Polymerase IIIon & of qu 9ven UoY Insertion mutagenesis Spliceosome Transcription Unit SNP Reverse transcriptase 1 Seminal work by Oswald Avery and colleagues demonstrated that DNA is what Frederick Griffiths called this etniog OS dotsM bioW 1-2kb of newly synthesized DNA strands are called this ainiog PS Assembly of the replisome is an orderly process that begins at these precise sites Snoiteeu 4 Transcribes ribosomal RNA genes in eukaryotes 5. A large nucleoprotein complex that coordinates activity at the replication fork Single base pair differences between homologous genomic regions isolated from different members of a population Complex of proteins and snRNAs catalyzing the removal of…
- COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGCBM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letter
- 40 Shown below is the antisense strand of DNA. What is the amino acid sequence that corresponds to this code? 5' AAAGCATACCGG 3' Second letter G. UUU Phe UCU UAU) Tyr UGC Cys UGU UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUA UCA UUG Leu UG CAU His CGU CGC CGA CGG CU CUU CUC CUA CUG CAC Pro Leu Arg CCA CAA) Gin CCG CAG AAU AUU AUC lle AUA AUG Met ACG ACU AGU AAC Asn AGC Ser ACC ACA Thr AAA1 AGA AAG Lys AGG Arg GAU) Asp GGC GAC Ala GAA GGU GUU GUC GUA Val GCU GCC Gly GCA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a PRO-VAL-SER-PHE PHE-ARG-MET-ALA GLY-HIS THR-LYS d LYS-ALA-TYR-ARG First letter Third letterGiven the template DNA strand 3’-TACCCTCAAGGGCAAACT-5’, provide the complimentary DNA strand, mRNA, tRNA, and protein using the figure that will post herend 2 minutes): Any RNA polymerase in any organism: O A Synthesizes RNA chains in the 3 to-5" direction O B. Binds tightly to a reqion of DNA located thousands of base pairs away from the transcobed rogion of the DNA OC Has proofreading activity O D. Separates DNA strands throughout a long region of DNA (up to tinousands of base pairs) and then copies one of them. OE Has a subunit called A (lambda), which acts as a proofreading ribonuclease OF. Can initiate synthesis of a new RNA chain without a primer
- 3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.First Letter A G U с 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the following DNA template strand, write out the amino acid chain produced. 23. Consider the following mRNA base codon sequence 5'-AUC-GAA-3' and the provided "Genetic Code-Reference". Genetic Code-Reference UUU UUC UUA UUG CUU CUC CUA CUG (mutated or silent) (mutated or silent) b. Briefly explain your reasoning for each. (be sure to include both parts) AULLY AUU a. Label which of the following would result in a mutated amino acid sequence or a silent mutation. (May help to first determine the original amino acid sequence, then compare to mutations) U Phe mRNA codon sequence: anticodon sequence: amino acid sequence: Leu Leu 5'-AUA-GAA-3' Val 5'- AUC-GAC-3' AUC Ille AUA AUAJ *AUG Met/Start GUU GUC GUA GUG UCU UCC UCA UCG) CCU) CCC ccc CCA 000 CCG ACU ACU ACC ACA ACG, C GCU GCC GCA GCG Second Letter Ser Pro Thr 3'-CAA-GTC-TGT-5' Ala UAU UAC) Tyr Туг A **UAA Stop UAG Stop CAU] CACJ…5’ GGACCTATCAAAATCCTTATGCGCTAGGATAGCTAACGCATCCAC3’ This is the template strand. The +1 transcription start site is bold. Transcribe template DNA to mRNA. Make sure you write mRNA in the 5’ to 3’ direction. This is tricky – don’t assume the polymerase knows right from left. It can only synthesize new DNA in 5’>3’ direction.