pecies 1: ATT GCA GGC TTG AAA pecies 2: ATA GAA GGT TTG AAC Make the simplifying assumption that all substitutions at the third codon position are ynonymous whereas substitutions at the first or second positions are onsynonymous. When filling in the blanks, write whole numbers without decimals (eg 8) and write on-whole numbers with a number in front of the decimal and two numbers after he decimal, rounded up (eg 0.15). ow many synonymous sites are there? here? ubstitutions are there? onsynonymous substitutions are there? A/ What is Ks? A/ How many nonsynonymous sites are A How many synonymous A/ A A/ What is Ka/Ks? How many A/ A/ positive selection acting, is purifying selection acting, or are the sequences volving neutrally. Vrite positive, purifying, or neutral in the blank to reflect your answer. What is Ka?

pecies 1: ATT GCA GGC TTG AAA pecies 2: ATA GAA GGT TTG AAC Make the simplifying assumption that all substitutions at the third codon position are ynonymous whereas substitutions at the first or second positions are onsynonymous. When filling in the blanks, write whole numbers without decimals (eg 8) and write on-whole numbers with a number in front of the decimal and two numbers after he decimal, rounded up (eg 0.15). ow many synonymous sites are there? here? ubstitutions are there? onsynonymous substitutions are there? A/ What is Ks? A/ How many nonsynonymous sites are A How many synonymous A/ A A/ What is Ka/Ks? How many A/ A/ positive selection acting, is purifying selection acting, or are the sequences volving neutrally. Vrite positive, purifying, or neutral in the blank to reflect your answer. What is Ka?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

Representations of sequencing chromatograms for variants of the a chain of human hemoglobin are shown here. Match each of the variants with the corresponding amino acid change. You can use the codon table to decode each amino acid sequence. For example, the first triplet encodes for Val. Normal Chongqing ddATP ddCTP ddGTP ddTTP Pro to Thr Gly to Asp Leu to Arg Karachi Swan River Answer Bank Ala to Pro Asp to Gly Pro to Ala Arg to Leu Asp to Asn Arg to Val
How many binary sequences of length n contain at most five 1 digits? The genetic code specifies an amino acid through a sequence of three nucleotides. Each nucleotide can be of one of the four types T, A, C and G, beingrepetitions allowed. How many amino acids can be encoded in this way?And if there are n types. Compare
What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. Enter just the number, nothing else! Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro- A lilP mutant called lilPXS is isolated that produces a truncated polypeptide of only 6 AA in length. Describe a single basepair DNA change that would lead to this truncated version of the protein. Multiple options are possible (100 words max.)
Consider the structure of Cro repressor protein from bacteriophage lambda E. It is a DNA binding protein, and like many sequence- specific DNA binding proteins, it must function as a homodimer Ex. Notice the mutual docking of a phenylalanine residue from each subunit into a hydrophobic pocket of the partner subunit. These hydrophobic interactions are required for dimerization. The noncovalent interactions highlighted in yellow are also required for dimerization. These interactions represent examples of: Osecondary structure O tertiary structure O quaternary structure O secondary AND quaternary structure Ⓒ tertiary AND quaternary structure
Consider the following original coding sequence of a gene that codes for a short 5- amino acid polypeptide: 5'-ATGGGCTCGAACTCATAA-3' Using the genetic code and the amino acid table below, which of the following sequences arises from a non-conservative missense mutation in the original sequence shown above? First base in codon U U A UUU UUC- UUA UUG- CUU CUC CUA CUG- U Phe (F) Leu (L) Leu (L) Second base in codon Val (V) UCU - UCC UCA UCG CCU CCC CCA CCG AUU ACU- AUC Ile (1) ACC AUA- ACA AUG Met (M) start ACG GUU GCU- GUC GCC GUA GCA GUG GCG- C Ser (S) Pro (P) Thr (T) Ala (A) UAU UAC UAAT UAG CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG A Tyr (Y) STOP His (H) Gln (Q) Asn (N) Lys (K) Asp (D) Glu (E) G UGU UGC UGA STOP UGG Trp (W) Cys (C) CGU CGC CGA CGG AGU AGC AGA 1 AGG GGU- GGC GGA GGG Arg (R) Ser (S) Arg (R) Gly (G) U C A G U C A G U C A G U C A G Last base in codon
For the following sequence, what is the Tm? 5'-AGCTACGATCAGGTCA-3'
The antibiotic paromomycin binds to a ribosome and induces the same conformational changes in 16S rRNA residues A1492 and A1493 as are induced by codon–anticodon pairing (Fig.). Propose an explanation for the antibiotic eff ect of paromomycin.
The amino acid sequences of a yeast protein and a human protein having the same function are found to be 60% identical. However, the corresponding DNA sequences are only 45% identical. Account for this differing degree of identity.
Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.
The human genome contains approximately 106 copies of an Alusequence, one of the best-studied classes of short interspersedelements (SINEs), per haploid genome. Individual Alus share a282-nucleotide consensus sequence followed by a 3'-adeninerichtail region. Given that there are approximately 3 * 109bp per human haploid genome, about how many base pairs arespaced between each Alu sequence?
Given the partial transposons DNA sequence 5’-ACCGTATTCGGT-3’ upstream from the central region, assuming both terminal inverted repeats and flanking direct repeats have 6 base pairs, hypothetically write the transposon structure downstream from the central region.
The human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…