Given the following information about amino acid tyrosine answer questions 1 & 2: A. HO pka3 10.1 NH₂ NH3 OO OO NH₂ pka2 9.01 conj acid B. HO D. HO OH pka1 2.2 NH3 NH₂ OH C. HO 1. Which of the above forms of tyrosine will be predominant in a solution with pH 9.5? 2. Which of the above forms of tyrosine is a cation?
Q: How many mL of 19 mM SDS would you need to make 76 mL of 2 mM SDS? Report your answer rounded to 1…
A: Molarity is a way of representing the concentration of a solution. Molarity is the number of moles…
Q: What are the symptoms of nicotinamide deficiency and why are they so similar to the symptoms of an…
A: Nicotinamide is one of the forms of a vitamin, Niacin (Vitamin B3) in which the carboxyl group of…
Q: Which electrolyte is most effected by hemolysis?
A: Hemolysis is the process of breakage of red blood cells. Hemolysis can be occurred due to viral and…
Q: True or False: Passive-mediated transport proteins lower the delta G of transport to create the…
A: Introduction :- The question is all about transport of molecules by diffusion I. e. Active and…
Q: Explain how an enzyme could distinguish between the (now circled) equivalent positions in the above…
A: Aconitase is an enzyme that catalyses the conversion of Citrate to isocitrate. Aconitase is an iron…
Q: 5. Consider the fatty acid. Which of the designations are accurate for the fatty acid? -O O A) (0-6…
A: Fatty acids are the monomer units for the lipid biomolecules. Fatty acids are classified into…
Q: 3. Researchers purified a new enzyme and during an initial characterization determined the Vmax to…
A: Enzyme inhibition is when an inhibitor bind to the enzyme at the active site or another site, which…
Q: Upon doing the experiment of Protein Denaturation, what could happen in the precipitation of strong…
A: Denaturation is the disruption and unfolding of a protein, resulting in the loss of its biological…
Q: 1. What role do eicosanoids play in the body? What is the primary fatty acid in their composition?…
A: INTRODUCTION : Eicosanoids - They are classified as a group of molecules which are being derived…
Q: AG" for reaction A B = -10 kJ/mol AG" for reaction BC = -8 kJ/mol AG" for reaction CD = 5 kJ/mol AG"…
A: The standard free energy change (∆G°) of a chemical reaction is the free energy change at the…
Q: HOW MANY of the following five items represent modes of protein denaturation? 1.) heating a protein…
A: Proteins are biomolecules composed of amino acids. Amino acids are joined together through peptide…
Q: Coupling ATP hydrolysis to glucose phosphorylation makes thermodynamic sense, but consider how the…
A: The two individual reactions i.e. glucose phosphorylation and ATP hydrolysis is given below, along…
Q: Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence…
A: Genetic information in our body is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: Please depict a noncovalent interaction important for the function of lysozyme
A: The enzyme lysozyme aid in the breaking down of polysaccharides in the bacterial cell membrane. They…
Q: Use the metabolite concentrations in the table to calculate the AG of the reaction above. Report…
A: Dihydroxyacetone (DHA) catalyzed into glycerol reversibly by enzyme glycerol dehydrogenase. NADH…
Q: Mechanism of action of electron transport inhibitors. Amital.
A: INTRODUCTION : First of all, there is no electron transport inhibitor called Amital, it is a wrong…
Q: For each pair of biomolecules, identify the type of reaction (oxidation‑reduction, hydrolysis,…
A: Enzymes are proteins that act as biocatalysts. Enzymes are classified into six classes based on the…
Q: 13. Southern blotting is separation of DNA by agarose electrophoresis and probing with a labeled…
A: The 'blot' in the different blotting techniques (southern, northern, western and eastern blotting)…
Q: What are the qualitative tests to characterize isolated RNA?
A: RNA or ribonucleic acid, most often single stranded nucleic acid found is all living organisms is…
Q: Once AMP and GMP are synthesized, they are then converted to ADP and GDP, then to ATP and GDP. What…
A: Adenosine & Guanosine are purine nitrogen bases. To these phosphate groups are attached. AMP…
Q: An unknown sample was tested if there is a presence of lipid, after the test it shows that it is…
A: These are the various preliminary and qualitative tests to estimate the presence and nature of…
Q: A. Effect of Enzyme Concentration Table 1. Effect of Catalase Concentration on Enzyme Activity…
A: "Since you have posted multiple questions, we will provide the solution only to the first question…
Q: 1. Lactoferrin is an iron-binding glycoprotein that forms the antibiotic fragment lactoferricin…
A: Ammonium sulphate is the commonly used salt for protein precipitation and extraction. Under high…
Q: could you please write the equation on paper with pen? I cannot understand the equation clearly.
A: The competitive inhibitors are the molecules which inhibits the enzyme catalyzed reaction by binding…
Q: Why stachyose can be used as prebiotic??how is the chemical structure of stachyose affect bacteria?
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: Following data were obtained in a study of enzymatic reaction that follows the Michaelis Menten…
A: 1. Km is the substrate concentration at which the Vmax is half. Km (concentration of substrate) =…
Q: 5. We're back in the lab having fun! Our current experiment calls for us to treat our cells with THC…
A: A stock or standard solution is one whose concentration is precisely known. Stock solutions can be…
Q: Symport and antiport proteins must be active transport proteins A)True B)False
A: The biological membranes are selectively permeable. Transport across the biological membrane can be…
Q: 1. Describe five major types of lipids.
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: Would increasing the concentration of glucose be a physiologically reasonable way to increase the…
A: In order to answer this question, first we need to find the intracellular concentration of glucose…
Q: Which of the following is the base component of the intracellular buffer? H₂CO3 HCO3 O H3PO4 O H₂PO4…
A: Buffers enable biological systems to maintain the pH within a particular range. Intracellular…
Q: Which of the following is TRUE under the following conditions: the enzyme concentration is 2.5 nM,…
A: The rate of reaction can be determined by using Michaelis Menten equation. Michaelis Menten equation…
Q: true/false: The majority of the urea cycle occurs in the cytosol of cells
A: In the mitochondria of liver cells, the urea cycle or ornithine cycle converts excess ammonia to…
Q: A plot of enzyme activity with and without an inhibitor present gave the following. Use two…
A: The rates of biochemical reactions are increased by proteins known as enzymes. Inhibitors are…
Q: Macmillan Learning All the dehydrogenases of glycolysis and the citric acid cycle use NAD+ (E'° for…
A: The value of free energy change helps to determine the spontaneity of a reaction. A positive ∆G…
Q: fatty acid designated as 20:0 is ________, while one that is designated 20:3 D5,8,11 is ________.…
A: Fatty acids are very important class of macromolecules in our body. They are the simplest type of…
Q: Kinesin movement is dependent on GTP hydrolysis. True False
A: Kinesin is a motor protein that is essential for the cellular functions like mitosis, transport of…
Q: Suppose researchers studied the first chromosome of a new species and mapped three genes of…
A: The frequency of recombination is a measure of genetic linkage that is used to create a genetic…
Q: (a) 2,3-Bisphosphoglycerate (BPG) reduces binding of O₂ to hemoglobin from almost hyperbolic to…
A: Hb is a protein responsible for carrying both O2 and CO2 in blood. 1 Hb protein is composed of 4…
Q: The proton gradient across the inner mitochondrial membrane is produced.... by passing electrons to…
A: ETC consist of four protein complexes called Complex I, II, III and IV that transport electron…
Q: 2. The lipids: a. They are found in high concentrations in cells in free form. b. They have one or…
A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question…
Q: Question 6 In membranes, one of the most common targets of reactive oxygen species are saturated…
A: Fatty acids are carboxylic acids with a hydrocarbon chain. Saturated fatty acids are fatty acids…
Q: what is the mechanism by organophospahtes inbibit enymes?
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Which enzyme in PPP creates glyceraldehyde 3 phosphate as a product? (Select all that apply)…
A: Pentose phosphate pathway (PPP) is an anabolic pathway that synthesizes pentose sugars and NADPH…
Q: Explain what a competitive antagonist is using a named example. In your answer, explain why a…
A: Introduction: An antagonist is a substance that does not cause any biological response itself but…
Q: Several of the enzymes of glycolysis fall into classes that What reaction participate in many other…
A: Enzymes are classified into different classes based on the nature of type of reaction they catalyse.…
Q: What are the Essential and Non-Essential Amino Acids? Describe each.
A: An amino acid is an organic compound that contains both an amino (-NH2) and carboxylic acid (-COOH)…
Q: potential is 140 mu, what Apt must be to maintain a proton motive force to 1.5 ATP from FADHZ? If…
A: Proton motive force (∆p) is the force developed through the proton pump which generates…
Q: 2. Enzymes of the pyruvate dehydrogenase complex.
A: PDC is a multienzyme complex that catalyzes the conversion of pyruvate to acetyl-CoA via glycolysis.…
Step by step
Solved in 3 steps
- Make use of the table below in answering the questions asked: Amino acid pK₁ pK₂ pK, Isoleucine 2.32 9.76 Leucine 2.32 9.74 Lysine 2.16 9.06 10.54 Tyrosine 2.20 9.21 10.46 I 1. Make sure to answer in two decimal places. What is the pl of the tripeptide ILY? 2. At pH 9.00, at which electrode will the ILY tripeptide be moving to? A. Anode B. Cathode C. The tripeptide will not move to either electrodes Make sure to show a solution or explanation for the answer.The amino acid arginine ionizes according to the following scheme: NH₂ I C=N I ΝΗ Part A pl = Submit H (CH₂)3 H-N-C-COOH II HH 1 [ΠΙ ΑΣΦ H H Calculate the isoelectric point of arginine. Express your answer using three significant figures. Request Answer pk-2.17 -H* +H* wwwww NH₂ C=N ΝΗ H (CH₂)3 1 ? H H-N-C-COO- | | H H 11 H pk-8.99 -H* +H* NH₂ I C=N I ΝΗ T (CH₂)3 H H H₂N-C-COO- I H pk - 12.5 -H* +H* NH₂ C=N=H NH I (CH₂)3 H₂N-C-COO- I H IVMake use of the table below in answering the questions asked: Amino acid pK₁ pK₂ pK, Isoleucine 2.32 9.76 Leucine 2.32 9.74 Lysine 2.16 9.06 10.54 Tyrosine 2.20 9.21 10.46 1. Kindly draw manually the structure of tripeptic ILY at pH 7.00 2. Kindly draw manually the most protonated structure of tripeptide ILY
- The pH vs charge graph for a triprotic amino acid is shown below. Please answer the following questions about the amino acid. 2 1.5 1 0.5 -0.5 -1 4 8 10 12 14 pH a. Which of the following triprotic amino acids is this? Histidine b. What is the isoelectric point? (Please select the appropriate range in which the isoelectric point falls) (Hint - look up the pka values in the pKa table for amino acids, which was in video one of today's lecture) 7-8 c. What form of this amino acid dominates at a pH of 8? Please select the correct form for each jonizable group. Alpha amino NH3+ Alpha carboxyl СОО- R| NH Net ChargeAt which pH would the peptide with the amino acid sequence 'KEYHR' be found in an IPG (Immobilized pH gradient) strip after successful isoelectric focusing. Show calculation. lonizable groups Alpha amine group of K Side chain group of K Side chain group of E Side chain group of Y Side chain group of H Side chain group of R Alpha carboxylic acid group of R pka 8.95 10.53 4.25 10.07 6 12.48 2.17The pH vs charge graph for a triprotic amino acid is shown below. Please answer the following questions about the amino acid. 2 1.5 1 0.5 -0.5 -1 4 6. 8 10 12 14 pH a. Which of the following triprotic amino acids is this? [ Select ] b. What is the isoelectric point? (Please select the appropriate range in which the isoelectric point falls) (Hint - look up the pka values in the pKa table for amino acids, which was in video one of today's lecture) [ Select ] c. What form of this amino acid dominates at a pH of 8? Please select the correct form for each ionizable group. Alpha amino [ Select ] Alpha carboxyl [ Select ] R [ Select ] Net Charge
- Place each charge form of alanine under the pH condition where it would be the predominant form. The pK₁ values for the carboxyl group and amino group of alanine are approximately 2.3 and 9.7, respectively. pH 11 H | H₂C-C-COO NH₂ Does not occur in significant amounts at any pHThe skeletal structures of the two amino acids, glycine and lysine, are given below along with the values of the relevant acid dissociation constants (pKa). NH,* PK, - 10.79 - HạN*CH2CO,¯ S pK¸=2.35 (CH2)4 - H3N*CHCO,- pK,=9,78 lysine (Lys) glycine (Gly) pK, = 9.18 pK, - 2.16 For an aqueous solution of glycine alone, calculate the value of pH at which the ratio of the concentration of neutral glycine zwitterions to the concentration of protonated cation is 102. On your under each of the following conditions. In the blank, provide the total charge of the dipeptide. (Example: If the charge is two plus write the answer simply as 2, if the charge is negative two write the answer as -2). draw the skeletal structure of the dipeptide, Lys-Gly, when it is solvated in an aque us solution i. pH= 1 ii. pH= 12Indicate which of the amino acid residues in the following peptide sequence contains a group that has a positive charge for its most likely charge state at pH 10. Asp-Tyr-Lys-GIn-Thr-Ile-Phe-Met-Ser (If none of the amino acids fit the criterion, select "none".) Asp Tyr ооооооооо Lys Gln Thr lle Phe Met Ser none
- The side chain of acetyl-L-lysine-OMe has a pKa=10.5 and its acid-dissociation reaction is shown below. see attachment for Question D.A 100 ml solution of 0.1 M amino acid (AA) at ph 1.0 was titrated with NaOH solution. The pH was monitored, and the results were plotted on the graph. The keypoints in the titration are designated I to VII. What is the possible identity of the amino acid? What is the isoelectric point of AA? what is the pKa corresponding to the dissociation of the alpha carboxylic group? Region/point where AA is predominantly present as a (-1) charged species? The effective buffering range for the amino acid in the acidic region? Region/point where the solution has 50:50 percent mixture of the (0) and (-1) speciesThe pH vs charge graph for a triprotic amino acid is shown below. Please answer the following questions about the amino acid. Net Charge 0 2 4 Alpha amino [Select] 6 R [Select] pH a. Which of the following triprotic amino acids is this? Alpha carboxyl [Select] 8 10 12 [ Select] 14 1 0.5 0 -0.5 -1 b. What is the isoelectric point? (Please select the appropriate range in which the isoelectric point falls) (Hint - look up the pKa values in the pKa table for amino acids, which was in video one of today's lecture) [Select] -1.5 c. What form of this amino acid dominates at a pH of 14? Please select the correct form for each ionizable group. -2