Choose the best answer for each blank. The pyruvate dehydrogenase (PDH) complex is regulated by the activity of pyruvate dehydrogenase kinase (PDK) and pyruvate dehydrogenase phosphatase (PDP). Phosphorylation of PDH by (1) _________ leads to (2) of PDH, whereas activation of (3) by (4)______ leads to activation of PDH as a result (5)__________. High energy charge activates (6)_ which (7)____________ PDH. 1111== 1) PDK, 2) inactivation, 3) PDP, 4) Ca2+, 5) phosphorylation, 6) PDK, 7) dephosphorylates 1) PDP, 2) inactivation, 3) PDP, 4) Ca2+, 5) dephosphorylation, 6) PDK, 7) phosphorylates 1) PDK, 2) inactivation, 3) PDP, 4) Ca2+, 5) dephosphorylation, 6) PDK, 7) phosphorylates 1) PDK, 2) activation, 3) PDP, 4) ADP, 5) dephosphorylation, 6) PDK, 7) phosphorylates O 1) PDP, 2) activation, 3) PDK, 4) ADP, 5) phosphorylation, 6) PDP, 7) methylates
Q: Muscle glycogen phosphorylase, an enzyme that provides glucose to the muscle for energy production,…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Given the Fischer projection structure of D-Lasallose below, show the step by step process of…
A: Given to us is a 7 carbon ketose sugar. We can number the carbon atoms as shown below. figure 1 The…
Q: in a specrophotometry ethanol determination experiment, you measured OD340 and assumed this…
A: Nicotinamide adenine dinucleotide: The molecules nicotinamide adenine dinucleotide (NAD) and…
Q: Why do we need to determine the extinction coefficient in order to calculate the initial velocity in…
A: Enzyme are proteins that catalyse biochemical reactions. A substrate binds at the active site of the…
Q: Which of the following are correct Dynein head elongates like a lever arm. ATP…
A: Movement of the body part is done by contraction and relaxation of contractile proteins.…
Q: For each pair of biomolecules, identify the type of reaction (oxidation‑reduction, hydrolysis,…
A: Enzymes are classified as oxidoreductases, transferases, hydrolases, lyases, isomerases, and ligases…
Q: Which reaction or reactions of glycolysis require ATP as a reactant? List the enzymes that catalyze…
A: Glycolysis is a catabolic pathway in which glucose is broken down into two molecules of pyruvate to…
Q: 1. Describe five major types of lipids.
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: Which of the following reactions does not occur mammals? O pyruvate + NADH-lactate + NAD+ O…
A: Pyruvate is the end product of glycolysis. In the presence of oxygen, it enters aerobic respiration,…
Q: Structure and formation reactions of phosphatidylcholine, phosphatidylethanolamine,…
A: Let us understand how phospholipids themselves are synthesized, then we understand how slight…
Q: HOW MANY of the following five items represent modes of protein denaturation? 1.) heating a protein…
A: Proteins are biomolecules composed of amino acids. Amino acids are joined together through peptide…
Q: What are ketone bodies and why do they form during fasting?
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: Which of the following will contain plain Galactose? Heparin Keratan Dermatan…
A: Carbohydrates can be classified into different types depending on their size into the following…
Q: a) Determine kcat (in units of sec-1) for a particular enzyme, given the following information: Vo =…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: 2. The sequence of starting region of one DNA gene is shown: 5' GCATATGGCTTTTCCGCCGCGGCGACGGCTGCGC…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: Glycogen synthase in the liver is a target for phosphorylation by two protein kinases. What are…
A: Glycogen is a storage-type homopolysaccharide that contains two types of glucose polymers: amylose:…
Q: true/false: Transamination reactions yield an a-keto acid and an amino acid.
A: The amino acids undergo reactions like transamination and deamination. As the name suggests the…
Q: 3) An enzyme that converts a functional group to another between two structures, A) oxidoreductase…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: Finally, using the formula to convert between standard states, show that that your calculated values…
A: Chemical standard state is defined by standard conditions in chemical systems. These standard…
Q: 3. Why can DNA adopt both A- and B- forms, while RNA is restricted to the A-form?
A: DNA is two strands of polynucleotide linked to each other in an antiparallel direction by hydrogen…
Q: What are the components of cephalins? Glycerol Two fatty acids Phosphoric acid Serine All of the…
A: Lipids are a very important class of biological molecule. Lipids can be classified into 2…
Q: Which of the following stabilize the hemoglobin quaternary structure of low-affinity to oxygen…
A: Haemoglobin is an important protein present in RBCs. It coprises of four subunits. Each subunit has…
Q: Write a short description of the physical characteristics of acid & enzymatic hydrolysates. What…
A: Introduction: The principle of the benedict test is that when reducing sugars when heated in the…
Q: * 15-14 AG AG is +6.64 kJ/mole +1.59 kcal/mole for the reaction Citrate - = Isocitrate. is -267…
A: Since conditions inside the cell are different than standard temperature and pressure, biochemists…
Q: Using Haworth projections, draw the structure of an a-disaccharide of mannose B(1,2) galactose…
A: The disaccharide of concern is made up of 2 monosaccharides; α-mannose and β-galactose. The…
Q: 21. _____________________________________ adds acyl groups to two carbons of the backbone of…
A: Triacylglycerol (TAG) are compounds which has 3 acyl groups attached to a glycerol molecule. Fatty…
Q: Complete the following reaction: P680 + light →_______→ O P680*; P680 + H+ O P680*; P680* + e O…
A: The P680 reaction center is a part of photosystem II. Upon getting hit by photons, P680 gets…
Q: b-oxidation occurs ONLY under aerobic conditions. Why? Glycolysis occurs under anaerobic conditions,…
A: Beta-oxidation of fatty acids is the process by which long chain fatty acid molecules are broken…
Q: Serine, cysteine, threonine can participate in hydrogen bonding. Valine cannot. Explain differences…
A: Alpha carbon of amino acids contains amino group, carboxyl group, hydrogen atom and side chain…
Q: Using the information in the following graphs that show activity of phosphofructokinase (PFK) with…
A: Phosphofructokinase is belong to glucose kinase group of enzyme and phosphofructokinase can be…
Q: 1. Comparative characteristics of glycogen metabolism in muscles and liver.
A: Metabolism is consist of both catabolic (breakdown) and anabolic (synthesis) processes. Glycogen is…
Q: A) what does the figure illustrate? B) Label the components in the figure pointed by the arrows and…
A: Our red blood cells (RBCs) are composed of hemoglobin that helps to transport oxygen throughout the…
Q: 5. Reciprocal regulation of glycogen phosphorylase and glycogen synthase activity.
A: Enzymes are proteins that aid in the speeding up of chemical reactions. Enzymes bind to substrates,…
Q: Following data were obtained in a study of enzymatic reaction that follows the Michaelis Menten…
A: 1. Km is the substrate concentration at which the Vmax is half. Km (concentration of substrate) =…
Q: Be able to describe how the “law of mass action” drives bicarbonate formation when the blood is in…
A: In a reversible reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the concentration…
Q: Which enzyme catalyzes the following reaction?
A: MM kinetics relates the initial rate of a reaction with initial substrate concentration when the…
Q: Glucagon causes [Select] Glucagon cause [Select] [Select] ✓ [Select] Glucagon causes [Select]…
A: Hormone glucagon is secreted by the pancreas in response to low glucose level. Glucagon primarily…
Q: In an enzyme mechanism that generates a negative charge in the transition state, which of the…
A: When a substrate(S) binds to the active site of an enzyme(E), it leads to the formation of an ES…
Q: Which aromatic derivative is the base name of the five membered ring of D-xylose named after? Ofuran…
A:
Q: Efficascent Oil liniment formulation
A: Efficascent Oil liniments are oils that are topically applied to relieve muscle pain, joint pain,…
Q: e) Draw a cartoon version of a lipid bilayer that illustrates the packing of several phospholipids…
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: Is increasing the P; concentration a reasonable way to couple ATP hydrolysis and glucose…
A: It makes sense to relate ATP hydrolysis and glucose phosphorylation by increasing the P…
Q: 1) Gluconeogenesis refers to ________. A) the breakdown of glycogen B) the formation of glucose from…
A: Generally, glucose is the preferred source of energy in our body. But of we are not eating properly…
Q: 2. Scheme of anaerobic oxidation of glucose and energy balance.
A: Organisms that live under anaerobic conditions rely only on glycolysis to generate ATP. Glycolysis…
Q: 17-21 Is the rea (PEP) a re
A: Glycolysis is the process of breaking down glucose into two pyruvate molecules results in the…
Q: Can human digest this trisaccharide?What bond is it between sugar B and sugar C?(be specific)
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: For each pair of biomolecules, identify the type of reaction (oxidation‑reduction, hydrolysis,…
A: Enzymes are proteins that act as biocatalysts. Enzymes are classified into six classes based on the…
Q: 1 enzymes are a class of proteins that catalyze biochemical reaction.what are ribozymes? 2 what is…
A: Enzymes are usually composed of proteins which catalyzes biochemical reactions by decreasing the…
Q: Draw the structure of the following: (in the image provided) Use the amino acids below. F -…
A: Recall that: Amino acids have an amino group, a carboxyl group and a side linked to the same carbon…
Q: 1. Classification, structure and properties of higher fatty acids, their biological role.
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Complete the following description of the mechanism of the pyruvate dehydrogenase complex by using words provided. Not all words will be used. Each word will be used only one time. Three enzymes of the pyruvate dehydrogenase complex work together to catalyze the production of Acetyl CoA from Pyruvate. First, a 2-carbon unit composed of Carbons # ____ and ____ of Pyruvate are added to the co-enzyme ______ and whereas Carbon # ______ leaves as CO. The C-2 unit together with the co-enzyme is called ______ .The C-2 unit is then transferred to the 2nd co-enzyme ____, which is initially in it ___ state. The enzyme that catalyzes this step is ______.From here, the C-2 unit is transferred to form a _____ linkage with CoA-SH to generate_____Complete the following description of the mechanism of the pyruvate dehydrogenase complex by using words provided. Not all words will be used. Each word will be used only one time. 5 Three enzymes of the pyruvate dehydrogenase complex work together to catalyze the production of Acetyl CoA from Pyruvate. First, a 2-carbon unit composed of Carbons # Pyruvate are added to the co-enzyme and whereas Carbon # of leaves as CO» The C-2 unit together with the co-enzyme is called transferred to the 2nd co-enzyme 11 12 The C-2 unit is then which is initially in its state. The enzyme that catalyzes this step is From here, the C-2 unit is transferred to form a linkage with CoA-SH to generate Acetyl COA Oxidized Hydroxyethyl TPP Phosphodiester Reduced Hydroxypropiony! TPP Lipoamide E-1 NADH 3 Dihydrolipoyl dehydrogenase Thioester 2 HydroxyacetyITPp Dihydropipoyl Transacetylase Type the words in the correct order separated by commas. Example: 1, 3, E-1, Thioester, Lipoamide ...What type of regulation would be expected when anaerobic metabolism is occurring in the muscle? Select all that apply. 1. Activation of pyruvate dehydrogenase kinase 2. Increased levels of calcium to activate pyruvate dehydrogenase phosphatase 3. Phosphorylation of pyruvate dehydrogenase 4. Inhibition of pyruvate dehydrogenase complex 5. Increased levels of NADH to activate citrate synthase 6. Increased levels of NADH to inhibit alpha-ketogluterate dehydrogenase complex 7. Increased levels of acetyl CoA to activate pyruvate carboxylase for gluconeogenesis
- Given the following question on the image identify the following:1. Total number of glucose molecules entering glycolysis2. Total number of pyruvate molecules produces at the end of glycolysis3. Total number of mitochondrial NADH produced after pyruvate is acted upon pyruvate dehydrogenase complex4.Total number of CO2 released right after the pyruvate dehydrogenase complex reactionConsider that the shuttle system is maltase-aspartate shuttleI'm confused about glycolysis and gluconeogenesis. Question: What is the function of glyceraldehyde 3-phosphate dehydrogenase? Is it because of -> The incorporation of a phosphate from ATP and reduction of glyceraldehyde 3-phosphate or ->The incorporation of phosphate from inorganic phosphate and reduction of glyceraldehyde 3-phosphate. or -> The incorporation of phosphate from inorganic phosphate and oxidation of glyceraldehyde 3-phosphateThe pyruvate dehydrogenase (PDH) complex catalyzes the oxidative decarboxylation of pyruvate to acetyl‑CoA and CO2.CO2. Multiple copies of pyruvate dehydrogenase (E1), dihydrolipoyl transacetylase (E2), and dihydrolipoyl dehydrogenase (E3) along with five cofactors form the PDH complex. Biochemists have studied the PDH complex for decades, in part due to its interesting use of substrate channeling during catalysis. What is the molecular mechanism of substrate channeling in the PDH complex? A. The swinging lipoyllysyl arm of E2 carries electrons and an acetyl group from E1 to E2. B.The active sites of E1, E2, and E3 undergo conformational changes that move products of one reaction to their next position without solvent exposure. C.Electrons and an acetyl group travel between E1 and E2 through a tunnel in E2. D. Metal ions coordinated with thiamine pyrophosphate (TPP) in E1 shield the electrons and acetyl group from scavenging by other enzymes until they reach E3.
- The pyruvate dehydrogenase (PDH) complex catalyzes the oxidative decarboxylation of pyruvate to acetyl‑CoA and CO2.CO2. Multiple copies of pyruvate dehydrogenase (E1), dihydrolipoyl transacetylase (E2), and dihydrolipoyl dehydrogenase (E3) along with five cofactors form the PDH complex. Biochemists have studied the PDH complex for decades, in part due to its interesting use of substrate channeling during catalysis. What is the benefit of substrate channeling? A. Intermediates of a multistep reaction sequence do not dissociate from the enzyme complex. B. Every intermediate or product made by the PDH complex enters the citric acid cycle as a substrate. C. The PDH complex sequesters excess substrate to use at later time. D. Reaction progress is not limited by the diffusion constant. E.The PDH active site forms in the hydrophobic core of the complex instead of a surface‑exposed region.Which of the following catalyzes a step that does NOT produce CO2? Group of answer choices alpha-ketoglutarate dehydrogenase complex malate dehydrogenase pyruvate dehydrogenase complex isocitrate dehydrogenase Citrate synthase is regulated by... Group of answer choices Concentrations of substrate and products Fructose-2,6-Bisphosphate Covalent modification Allosteric regulation by the levels of NADDHGlycogen that is broken down in the muscle is not released as glucose into the circulation because the muscle lacks... Group of answer choices glucose-6-phosphatase phosphoryalse glycogen synthase hexokinase
- In animal tissues, the ratio of active, unphosphorylated to inactive, phosphorylated pyruvate dehydrogenase (PDH) complex regulates the rate of pyruvate conversion to acetyl‑CoA. Choose an answer in the brackets to finish the sentences. Treatment of a preparation of rabbit muscle mitochondria containing the PDH complex with pyruvate dehydrogenase kinase, ATP, and NADH causes the rate of this reaction to [decrease, increase, stay the same] Treatment of a preparation of rabbit muscle mitochondria containing the PDH complex with pyruvate dehydrogenase phosphatase and Ca2+Ca2+ causes the rate of this reaction to [decrease, increase, stay the same] Treatment of a preparation of rabbit muscle mitochondria containing the PDH complex with malonate causes the rate of this reaction to [decrease, increase, stay the same]Pyruvate dehydrogenase kinase-4 (PDK-4) is a widely expressed isoform of PDK and is responsible for inhibiting pyruvate dehydrogenase (PDH) complex activity via phosphorylation. When PDK-4 is active, the PDH complex is in its phosphorylated state and pyruvate cannot be converted into acetyl-CoA for entry into the citric acid cycle. Instead, in gluconeogenic tissues like liver and kidney, pyruvate is channeled to support gluconeogenesis. Conversely, when PDK-4 is inactive, the PDH complex readily converts pyruvate into acetyl-CoA. A researcher wants to determine the role of PDK-4 on blood glucose homeostasis. To accomplish this, she proposes to generate a PDK-4 knockout mouse using CRISPR technology. To create the knockout mouse, she must first generate PDK-4 knockout embryos to implant into pseudopregnant female mice. Arrange the steps to outline the process by which she will generate the PDK-4 knockout embryos. First step Last step Answer Bank Generate Cas9 mRNA and sgRNA specific to…Of the allosteric enzymes listed below, which are suppressed by NADH? Select all that apply. the pyruvate dehydrogenase complex a-ketoglutarate dehydrogenase complex U isocitrate dehydrogenase pyruvate kinase Ophosphofructokinase hexokinase Oglucokinase