A original pedigree: 8 alleles 3 78 13 1 2 12 34 34 5 6 23 56 7 8 9 10 11 12 37 17 26 25 36 35 Using the same pedigree as the last question (included above), how many recombinant individuals are in the pedigree when testing the linkage between the disease and the marker (i.e. the alleles listed below each shape)? 1 recombinant 3 recombinant 5 recombinant O recombinant
Q: iruses that kill host cells are (a) lysogenic (b) lytic (c) viroids (d) prophages (e) temperate
A: In virology, the relationship between viruses and their host cells can lead to diverse results,…
Q: Can u give me the correct answer
A: Solution: (information required was not provided. One possible food web is provided in the image…
Q: Question 7 Take Quiz Exit 0.5 pts The only force of evolution that adds new gene variants to the…
A: Question 7The correct answer is A. Mutation.Explanation:Mutation: Mutation is the only force of…
Q: Question #1. Briefly discuss and compare the plant habit and reproductive structures of the…
A: Seedless vascular plants, such as Psilotum, Lycopodium, Equisetum, Selaginella, Adiantum,…
Q: I have a vial of F2 offspring resulting from a two-generation cross between true-breeding wildtype…
A: Approach to solving the question:I derived the expected number of fruit flies by applying Mendelian…
Q: A bacterial culture is initially composed of 100 cells. After 1 hour the number of bacteria is 1.5…
A: The given answer calculates how long it will take for bacterial populations to quadruple in perfect…
Q: What are the similarities and differences in each part of the forelimb of a moth, Pteradactyl, bird…
A: The objective of this question is to compare and contrast the forelimbs of a moth, Pteradactyl,…
Q: 20) Biological control of Salmonella is by using: a) E. Coli (ETEC Strain) b) Shigella c)…
A: 20. Control of Salmonella using Bdellovibrio: Bdellovibrio is a unique predatory bacterium that…
Q: Explore the differences between positive inducible, positive repressible, negative inducible, and…
A: When an inducer molecule binds to a repressor protein, it undergoes a conformational shift that…
Q: 18
A: DNA sequence 5'ACCTGTGCAATATACGGCCAT3'3'TGGACACGTTATATGCCGGTA5'mRNA5' ACCUGUGCAAUAUACGGCCAU 3'Amino…
Q: Tell how the impact of the Tuskegee Syphilis Study on the following: • Men involved in the study and…
A: Furthermore, the effects of the Tuskegee Syphilis Study on African Americans' access to the Covid-19…
Q: -Centromere D D Ø ☹ A B ℗ ℗ D E C
A: The objective of the question is to understand the chromosomal condition during the prometaphase…
Q: Calculate the amount of protein (in mg) in Sample 1 if the measurement at A280 = 0.636, taking into…
A: The amount of protein in a sample can be found by using a special machine that measures how much…
Q: What is the name of the disease caused by pneumococcal bacteria?
A: The objective of the question is to identify the disease caused by pneumococcal bacteria.
Q: Joe suffers from pernicious anemia because his body is unable to produce intrinsic factor. Which…
A: The question is asking us to identify the part of the digestive system that is not functioning…
Q: 7. Complete the following diagram which describes a small eukaryotic open reading frame, by filling…
A: Template Strand:The template strand is indeed the DNA strand that serves as a template during…
Q: You need to resuspend lyophilized protein in a solution of 5mM HEPES with 20% glycerol. Describe how…
A: Resuspending lyophilized proteins in buffer solutions is basic in numerous biochemical and…
Q: If there are 103 cells per mL at the middle of log phase, and the generation time of the cells is 30…
A: To unravel this, we have to calculate how numerous times the cells isolated in 2 hours, given that…
Q: Why is the control of gene expression important for cells? Choose one: It ensures the accurate…
A: The question is asking us to identify the primary reason why the control of gene expression is…
Q: Repeated white cell counts could be helpful in managing patients who are taking therapeutic agents…
A: The objective of the question is to determine whether repeated white cell counts can be beneficial…
Q: E2F is a transcriptiion factor that activates genes for DNA rep- proteins. In addition with RBR,…
A: The capacity of a single cell to isolate and create into a whole organism is known as totipotency.…
Q: Relative Hormone Concentration 8 12 ♡ Days of Estrous Cycle The graph above shows the hormonal…
A: Approach to solving questions about a graph:Identify the key elements:Labels: Look for titles, axis…
Q: Answer the following questions about CRISPR below: A.What is a PAM sequence? B.How does the…
A: A. PAM Sequence:A PAM sequence, or Protospacer Adjacent Motif, is a specific DNA sequence that is…
Q: ering where Fucus lives, what do you think is the function of its gelatinous sheath?
A: Fucus, commonly known as rockweed or bladderwrack, could be a sort of brown algae found in…
Q: 24
A: The diagram shows alternative splicing, a process where a single pre-mRNA molecule can be spliced in…
Q: Describe at least 3 traits that are different between Old World Monkeys and Apes. Is Curious George…
A: The objective of the question is to identify the differences between Old World Monkeys and Apes, and…
Q: Bone marrow continues producing RBCs as long as tissue hypoxia is present or until adequate tissue…
A: The objective of the question is to verify the understanding of the process of red blood cell (RBC)…
Q: Which statement is not true of the chytrids? (a) they are simple aquatic fungi (b) they produce…
A: Chytrids are a special bunch of fungi distinguished by their primitive characteristics, which…
Q: For the VWA locus, Sophie has two alleles, 16 & 18. She inherited the allele with 16 copies from…
A: Answer well explained above
Q: Detail the molecular pathophysiology that leads to cystic fibrosis-related diabetes.
A: Cystic Fibrosis-related diabetes (CFRD) is a common and important complication of cystic fibrosis…
Q: Why does hepatitis D only occur in patients with hepatitis B?
A: 1. Dependence on HBV for Replication: Hepatitis D virus (HDV) is a defective RNA virus that lacks…
Q: Part 3 - Label the structures indicated in the transverse abdominal section shown. 2. 3. 1. 4. 5. 6.…
A: Here's a brief overview of each of the anatomical structuresVertebra:Vertebrae are the individual…
Q: What is suspected when the hematocrit has decreased by 4% and the total bilirubin level is increased…
A: The objective of the question is to identify the possible medical condition based on the given…
Q: how infectious pathogens are distributed , give 5 examples
A: The objective of this question is to understand how infectious pathogens are distributed and to…
Q: Consider this scenario following several generations of frogs and then answer the following…
A: In the context of evolution, the key indicator of evolution occurring is a change in the allele…
Q: 44. The use of chemical agents to kill or inhibit the growth of microorganisms within their host’s…
A: The answer is d) chemotherapeutic, and here's a breakdown of why the other options are less…
Q: 2 OF 11 QU Answer all that apply. Traditionally, the Out of Africa Model of modern human origins…
A: The Out of Africa Model, also known as the "recent single-origin hypothesis" or "Replacement Model,"…
Q: Would breathing pure oxygen cause a large increase in oxygen transport by the blood in a healthy…
A: Inhaling pure oxygen can influence a person's body in several ways depending on their overall health…
Q: Consider the following two nonhomologous wildtype chromosomes, where letters or numbers represent…
A: AThe rearrangement in scenario A is a tandem duplication, where the duplicated segment GH is…
Q: Question 4 1 pts What terms best describes the ability of muscle to recover from contraction? ○…
A: The objective of the question is to identify the term that best describes the ability of a muscle to…
Q: Leukemic lymphoma is when Question 3 options: A) Lymphoma cells have…
A: Leukemic lymphoma refers to a condition where lymphoma, a type of cancer that originates in the…
Q: What topics about opioids would you try to change to address thenegative impacts of the opioid…
A: Prescribing Practices: This point highlights the need to educate healthcare professionals about…
Q: Imperial China during the Ming dynasty (1368-1644 CE) could conceivably have started the Scientific…
A: The question is asking us to identify which of the given factors would not have contributed to…
Q: What physical appearance (Solid, liquid, semi-solid) of following Media: Broth tube, agar slant…
A: Agar is a polysaccharide composed of agarose and agaropectin. It is a gelatinous substance used in…
Q: Genetics Q7
A: The question is asking about the direction of movement of DNA during gel electrophoresis, a…
Q: Which of the following is NOT an adaptation among plants to increase access to nitrogen?…
A: Mutualistic association with fungi that convert atmospheric nitrogen into a biologically available…
Q: List and describe the three major phases of inflammation.
A: Inflammation is like a well-orchestrated battle within your body. Imagine tiny soldiers (immune…
Q: a) Indicate the chronological order the following RNA processing events by indicating a number (from…
A: Step 1 Here's the chronological order of the pre-mRNA processing events: Pre-mRNA processing…
Q: You hit the gym, releasing dopamine, noradrenaline, and serotonin in your brain. What are these…
A: Dopamine, noradrenaline (also known as norepinephrine), and serotonin are neurotransmitters or…
Q: MAKE A GRAPH FOR ME ON GRAPH PAPER CALL IT ENZYMES VS RATE OF REACTION USING TABLE BELOW GRAPH…
A: Please give me helpful rating if you are satisfied with the graph.
Step by step
Solved in 2 steps
- Normal wife Affected husband As a genetic counsellor you are presented with a married couple where one of them has a family history of this disease. The husband is affected by this disease and the wife is normal. The couple, who are thinking of starting a family, would like to know what their chances are of having a child born with this condition. They would also like to know what the probabilities are of having an affected boy or affected girl. Use the symbols above to complete the diagram right and determine the probabilities stated below (expressed as a proportion or percentage). Parents 4. Determine the probability of having: Gametes (a) Affected children: Possible (b) An affected girl: fertilizations (c) An affected boy: O O O O Children Affected aite if 耳In a cross between mice the genotypes AB/ab x ab/ab, what is the recombination frequency if the progeny numbers are 72 AB/ab, 68 ab/ab, 17 Ab/ab, and 21 aB/ab? The alleles are shown for each chromosome, separated by a slash (/)GsnKivd010j2gIRWLIZOMZZ-VibKYvBbo61ylATAQ/viewform RECOMBINATION". For numbers 7-35, reler to the given data below. Glven the following testcross data for com In whlch the genes for fine stripe (f), bronze gleurone (bz) and knotted leaf (Kn) are involved: + = wild type f fine stripe +=wild type bz = bronze gleurone +=wild type Kn knotted leaf %3D Genotype Ko f Number 451 Ko 134 97 436 bz bz bz Ko 18 119 f 24 Kn f bz 86 Total: Your answer 7-8. What would be the recombination frequency or the frequency of the recombinant type between +/Kn and +/f genes? Oa. 16% O b. 16 map units + + + + +
- Phenotype chr1.1 chr2.8 chr3.12 chr4.12 chr4.55 chr7.88 chr9.55 chr10.1 chrX.1 chrX.5 Purple AA AT Purple AA AT F F GG GC 80 CC CC TT TT TT CT 80 CC CC AT TT TT CT 8 CC CC AT AT GG CT GC TT CC AT AT GT 10 CT Yellow AA AT TT GC Purple and AA TT Yellow F Purple AA AT AA GG TT GC AT TT TT CT Purple AA AT AA GG TT GC AT TT TT CT Purple AA AT AA Purple AA AT AA 80 CC TT GG AT TT TT TT 646 GG CC GG AT TT TT TT Purple and AA TT AT CC 80 Yellow 80 CC GG AT AT GT TT Purple AA AT AT CC CC GC AT F TT TT TT E Purple AA AT AT CC TT GC AT TT TT CC Purple AA AT E 00 CC TT GG AT TT TT CC Yellow AA AT AT GC TT 00 CC AT AT GG CC 80 TT E AT AT GC CC CC AT AT GG TT Yellow AA AT AT GG CC CC AT AT GG Yellow AA ধ 80 CC CC AT AT GT TT GG TT GG AT AT GG TT Purple and AA AA AT GG Yellow Yellow AA AA F 80 CC GG AT TT TT CC 80 GC CC GG AT AT GT CC Purple AA AA AT GC Purple and AT AA Yellow Purple AA AA F F GG 80 CC GG AA TT GT CCThe recombination frequency in a cross can never exceed 50%. Explain why is this limit?The results of a paternity test using short tandem repeatsare listed in the table below. Who’s the daddy? How sureare you?
- Assuming both hemophilia and red-green colorblindness are rare traits, who is recombinant in generation III? (Select all that apply.) Male 甲 Female I Hemophilia A O Hemophilia B %3D Color-blind Hemophilic and color-blind None IlII-3 male III-1 male III-2 male III-4 maleA blood stain from a crime scene and blood samples from four suspects were analyzed by PCR using fluorescent primers associated with three STR loci: D3S1358, vWA, and FGA. The resulting electrophoretograms are shown below. The numbers beneath each peak identify the allele (upper box) and the height of the peak in relative fluorescence units (lower box). Solve, (a) Since everyone has two copies of each chromosome and therefore, two alleles of each gene, what accounts for the appearance ofonly one allele at some loci? (b) Which suspect is a possible source of the blood? (c) Could the suspect be identifi ed using just one of the three STR loci? (d) What can you conclude about the amount of DNA obtained from Suspect 1 compared to Suspect 4?Which of the following terms means many genes? polymorphism polygeny polypeptide multiple alleles
- Pedigree Analysis Is a Basic Method in Human Genetics Using the pedigree provided, answer the following questions. a. Is the proband male or female? b. Is the grandfather of the proband affected? c. How many siblings does the proband have, and where is he or she in the birth order?Pedigree Analysis Is a Basic Method in Human Genetic: What does OMIM stand for? What kinds of information are in this database?The recombination process below occurs when two recombination occurs between two different alleles, but only only one of the alleles is perpetuated in the final product. This process is called [x]?