Q: Determine if the cells in telophase I of meiosis are haploid or diploid.
A: Telophase I is a phase observed in the process called meiosis. Meiosis or reductional division is…
Q: The parents in the family above produce another son, this time with two Y chromosomes and normal…
A: 1. We all know that for male progeny to occur in human is that it gets its X chromosome from his…
Q: identical in all EVOLUTION LINK The reactions of glycolysis are organisms-prokaryotes, protists,…
A: Cellular respiration is a metabolic process that takes place inside the cell resulting in usage of…
Q: Plz answer this all questions What muscle in the shark is homologous with the geniohyoideus in…
A: The common mudpuppy is a species of the salamander belongs to the genus Necturus. They live an…
Q: arrived from the mainland 100 years (at least 50 generations) ago on been little or no gene flow…
A: Many of the hypothese regarding the genetics of adaptation require that one know specific details…
Q: Why do we compare allometric relationships with a line of unity?
A: The allometric relationship is the relationship of body characteristics like anatomy, Physiology…
Q: 22. VIRAMUNE Oral Suspension contains 1% w/v of nevirapine. Calculate the milli- grams of nevirapine…
A: VIRAMUNE: Nevirapine (NVP), marketed among other names as Viramune, is a drug intended to treat and…
Q: Which of the following is an illustration of experience-dependent plasticity? A) Rats raised in…
A: Introduction- experiences can profoundly shape the structure and function of the brain. This…
Q: - Solve the following genetic problems with a Punnett square 1. An organism that shows a dominant…
A: Introduction : Genotypenis defined as the genetic information passed down from one generation to…
Q: Why is it essential to balance your 400 mL of cell culture before centrifuging?
A: Ans: A centrifuge is a machine which use centrifugal force to separate the components of a mixture.…
Q: This is affected by things like v enzymes, including collagenase, that are released from the…
A: Bacteria constitue large number of unicelluler organisms. These are mostly belong to kingdom…
Q: How can this fusion be done? Can something be done using tissue engineering and 3D printers? What…
A: 3D printing: The process where the biomedical structure in a three-dimensional form can be printed…
Q: The brain is particularly sensitive to being shaped by input from the environment during sensitive…
A: Developmental psychology is a discipline of psychology that is concerned with the processes and…
Q: Ⓒ Macmillan Learning There are many examples of species that were ancestral to or closely related to…
A: The blanks can be filled with the following suitable options. Dark blue(bottom most) -…
Q: GENETICALLY MODIFIED CROP: mRNA 5' tRNA nucleus O Į CAGTTAATGGAGCGATGCCTGGATGGAGAAATCAATTAG nucleus…
A: The genetic code is a set of instructions that enable live cells to produce proteins using genetic…
Q: F. How much of a 100 mg/mL stock of Ampicillin would you need to add to 400 mL for a 100 ug/mL final…
A: Given data:- Concentration of stock of ampicillin = C1 100mg/ml. Volume of stock solution required…
Q: 1. Chicken Human Mouse Lancelet Zebrafish Frog Drosophila a. Which lineage of vertebrates shows the…
A: Phylogenetic tree is a diagrammatic illustration which determines how taxons are related to each…
Q: Genetic drift: is variation in the relative frequency of different genotypes in a small population,…
A: Genetic drift It is mechanism of evolution, responsible for random changes in the gene pool. It…
Q: Vitamin list: Vitamins may be used more than once Thiamin Folate Riboflavin Vitamin B12 Niacin…
A:
Q: A mutation that results in a premature (early) stop codon, will terminate transcription resulting in…
A: Transcription is a process by which mRNA is made by rna polymerase using dna as a template. When…
Q: Suppose you have a drug that specifically inhibits telomerase. You administer the drug to mice.…
A: Introduction :- A significant ribonucleoprotein complex called telomerase is in charge of…
Q: what are the goup of muscles that is working to allow a hip flexion in a squat?
A: Introduction Squats are a complex exercise. They therefore engage a number of lower body muscle…
Q: Considering the anatomy of reptiles and amphibians explain the difference between these two 2…
A: Reptiles and amphibians are the important organisms under the animal kingdom. They are tetrapods…
Q: II. Cultural characteristics of yeasts. Below is the colony diameter for each yeast culture grown on…
A: Yeasts are single-celled, eukaryotic microorganisms that belong to the fungal kingdom. There are…
Q: In gel electrophoresis and column chromatography, why do large molecules migrate more easily in one…
A: Gel electrophoresis is the separation technique used to separate molecules based on their charge and…
Q: How does the intake of Caffeine cause disruption in deep in older people? Please provide the…
A: Answer Using caffine by old people can cause disruptive sleep. The stimulant's most evident side…
Q: A histological specimen of submandibular salivary gland represents basket * cells from which some…
A: Introduction :- Saliva is produced by salivary glands and maintains strong teeth while also…
Q: Which of the following blood-related activities is not controlled by the endocrine system? Multiple…
A: Ans - Third answer of first image. Endocrine system do not produce hormones that asist in blood cell…
Q: Which of the following is the best definition of a molecular marker? a gene that is likely to be…
A: a molecular marker is a fragment of DNA that is associated with a certain location within the…
Q: Choose all the answers that apply. Where are osteoprogenitor (osteogenic) cells found?…
A: Introduction: Osteoprogenitor cells, sometimes termed to as osteogenic cells, are stem cells that…
Q: How does intercellular co2 (Ci) relate to photosynthesis? Does more light increase or decrease…
A: Photosynthesis is a process in which plants use carbon dioxide, water and sunlight to synthesize…
Q: Hydromorphone hydrochloride supposi- tories contain 3 mg of active ingredient and weigh…
A: 39. Given, hydromorphone hydrochloride suppositories contain : Active ingredient = 3mg, and Total…
Q: How do cats drink?
A: Answer : Cats drink water by what we call cat's lapping stratigy.Water stuck to the tip of a cat's…
Q: Demonstration of Osmosis using Potato Osmoter 1. Where was the liquid cavities of some of the…
A: Introduction: The osmosis phenomena in living plant cells is demonstrated using a potato osmometer.…
Q: In a saliva of the patient the contents of enzymes is reduced. What cells of secretory portion do…
A: Salivary glands are made up of secretory units also known as acini and ducts. Ducts are highly…
Q: Determine if the cells in prophase II of meiosis are haploid or diploid.
A: Mitosis and meiosis are two kinds of cell division that occur to form daughter cells. Mitosis occurs…
Q: Acetylcholine is a neurotransmitter that, when bound to its receptor, causes the receptor to open a…
A: Introduction:- Neurotransmitters are the chemical signalling molecules which helps in the…
Q: 3d bioprinting systems, biomaterials, tissue engineering. Find a creative project topic on the…
A: Tissue engineering is a highly sophisticated and modern technique that is utilized in today's world…
Q: Digestion of the macronutrients begins in different parts of the GI tract. Apply what you have…
A: In the process of digestion large macro molecules are broken down into smaller units.
Q: The genomes of two E. coli strains are compared in Figure 14-19. Would you expect any third strain…
A: The availability of this genome sequence will aid in the identification of genes responsible for…
Q: what is the qualitative anatomical analysis of a squat active
A: A basic human movement that may be seen in almost all facets of life is the squat. In addition, it…
Q: Why are onion root tips and whitefish blastula used to study mitosis?
A: Cell division is a phenomenon in which parent cells undergo splitting and give rise to new cells. So…
Q: E. coli BL21 cells carrying a pQE expression vector can be induced to produce large amounts of a…
A: Ans is f - glucose, E. coli BL21 Cells carrying a PQE expression vector can be induced by adding…
Q: What is predator management? What is the linkage between the evolution of prey and predator species…
A: 1) Predator management is a strategy used in wildlife management that aims to control the numbers of…
Q: The graph shows the rate of transpiration (Est) for four plant species. Nothofagus dombeyi was the…
A: N.dombeyi at mid day in summer, suggesting reversible reduction in photochemical efficiency of…
Q: Which of the following gene regulatory molecules act in trans. Check all that apply. The lac…
A: Introduction:- The gene regulatory molecules helps in regulating the expression of different genes,…
Q: Considering the values in the following table, what relationship can be observed between the amount…
A: WATER POTENTIAL - Water potential is the amount of energy needed to move an infinitesimally small…
Q: Macmillan Learning There are many examples of species that were ancestral to or closely related to…
A: Australopithecus afarensis existed between 3.9 to 2.9 million years ago(mya). So, the first blank…
Q: Some friends are trying to make wine in their basement. They've added yeast (which is a facultative…
A: Introduction The metabolic process of fermentation involves the action of enzymes to cause chemical…
Q: Indentify the correct food web for each question. Which type of food web cycles materials and moves…
A: INTRODUCTION Food chain : it explains who eats whome in a wild. This helps to the flow of energy and…
Step by step
Solved in 2 steps
- 19. Which of the following nitrogenous bases are classified as pyrimidines? Group of answer choices cytosine and guanine cytosine and thymine adenine and uracil adenine and guanineWhich of the following elements is not a micronutrient? boron calcium chromium manganeseThe building blocks of nucleic acids are ____. a. sugars b. nitrogenous bases c. peptides d. nucleotides
- 4. Which atom with a lone pair in the structure contributes to theresonance property of the nucleotide? Choose the letter of youranswer in the structure.5. How many hydrogen bonds is the structure pointing at E capableof forming?6. What is the name of the nitrogenous base which iscomplementary to pair with the nitrogenous base in the structure?the DNA consists f 2 strnds hold together by which bond?Group the following as nitrogenous bases and nucleosides:Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine.
- 15. 2 1 3 - What part of the nucleotide represents a nitrogen base? O 01 None 2 31. What bonds are responsible for joining the pentose sugar of one nucleotide to the phosphate group of the other nucleotide? 2. What bond connects the nitrogenous base to the pentose sugar?7. The diagram below represents a portion of a deoxyribonucleic acid. 10 sbrio od Which sequence of base pairs along the bottom complemen the base pairs labeled on the top side of the nucleic acid? Gun m A ATGC B UACG OTACG D GCAU
- tue 16. Identify the molecule below H H H-N-C- C ОН CO ovo -CIR17. All nucleotides have the same organization, a phosphate group attached to a pentose (a 5 C sugar), and a nitrogenous base attached to the pentose as well. The polynucleotides (DNA & RNA) carry information in: a) the native conformation b) the backbone of the molecule c) the linear sequence of nitrogenous bases from beginà end d) the ribofusionIn contrast to the double helix of DNA, RNA exists as asingle strand. What effects does this have on the structureof RNA?