Q: What labels goes to active immunity and passive immunity
A: Immune response is the physiologial process which involves our body immune cells to identify and…
Q: Assume that blood type is inherited as A and B dominant over O, but A and B are codominant over each…
A: Proteins for blood groupings such as A, B are present on the surface of red blood cells.
Q: Describe the trends in global fish capture from 1950 to 1990 and from 1990 to 2016. Describe…
A: loss of wildlife species, and also local decreases in population density. Today, the loss of marine…
Q: GENETICALLY MODIFIED CROP: mRNA 5' tRNA nucleus O Į CAGTTAATGGAGCGATGCCTGGATGGAGAAATCAATTAG nucleus…
A: The genetic code is a set of instructions that enable live cells to produce proteins using genetic…
Q: Amelia is a very curious young toddler. She usually explores new environments with ease, though she…
A: option A Child's environment influencing child's phenotype.
Q: What does maximum assimilation (amax) tell us about the plants photosynthetic rate?
A: Photosynthesis is the process by which plant convert the light energy from the sun to the chemical…
Q: The enzymes of the citric acid cycle are located in the a. Inter membrane space of mitochondria…
A: The citric acid cycle is an important metabolic route that links the metabolism of proteins, fats,…
Q: Which of the following is not a tissue-resident macrophage? Kupffer cells circulating…
A: Please follow step 2 for detailed explanation.
Q: Identify 2 or more DNA-based technologies and discuss their combined applications in…
A: We need to discuss the combined uses of two technologies in the generation/development of a DNA…
Q: How can this fusion be done? Can something be done using tissue engineering and 3D printers? What…
A: 3D printing: The process where the biomedical structure in a three-dimensional form can be printed…
Q: Enzymes catalyze a chemical reaction by A. decreasing the amount of ATP required to activate a…
A: Enzyme is a protein is a substance. Friedrich Wilhelm Kuhne was the one who coined the term ' Enzyme…
Q: 3d bioprinting systems, biomaterials, tissue engineering. Find a creative project topic on the…
A: Tissue engineering is a highly sophisticated and modern technique that is utilized in today's world…
Q: 25. Which of the following can cause diarrhea? a. accumulation of extracellular glucose b.…
A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question…
Q: Individuals with genotype A have a lifetime reproductive success of 4. Individuals with genotype B…
A: Fitness is the reproductive success of an organism. The nature will select the organisms that have…
Q: 9. Creep is best described as the change in length of a tissue in response to a period of time. a.…
A: Creep is a time dependent deformation at constant stress and increased temperature.
Q: Is biological magnification still a problem?
A: Any concentration of a toxic substance, such as insecticides, in the tissues of resistant organisms…
Q: II. What is the probability that this pair of parents will produce the indicated offspring? Aa Bb DD…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: During Pavlov's experiment, after many pairings of the sound of the bell and presentation of food,…
A: The term Cognition refers to the ability to acquire, think, process, understand, and remember…
Q: The transpeptidase activity of penicillin binding proteins (PBP) promotes:
A: Penicillin-binding proteins are a group of proteins that are characterized by their affinity for and…
Q: What is water stress? Discuss it causes and effects.
A: Answer: When there is more demand for water than there is supply at a given time, as well as when…
Q: 1A.If transcription factor G is downstream of EGFR and upregulates gene H, what happens to H if Grb2…
A: Introduction:- Cell signalling is a mechanism that leads to relay of signal or information received…
Q: Explain the importance of MSH2 and MSH6 in regards to adenocarcinoma colon cancer
A: Cancer is a condition in which cells proliferate uncontrollably and infiltrate, destroy, and kill…
Q: Which of the following organisms cannot perform oxidative phosphorylation? Select one: a. E. coli b.…
A: Oxidative phosphorylation refers to the production of ATP by ADP driven by energy released from the…
Q: Explain the function of large male canines in a sexually dimorphic primate species:
A: Forensic anthropologists can distinguish between male and female bones because people are sexually…
Q: Explain what are the advantages and disadavatges of the CIN, MSI, CIMP pathways and the inflammatory…
A: The Mendelian gene is a basic unit of heredity and the molecular gene is a sequence of nucleotides…
Q: 50 Labels An injury punctures a blood vessel in the body. A cascade of enzymatic activity results in…
A: A human or other vertebrate's complete body is maintained by a system of organs called the blood…
Q: Examine the illustration below and answer the following questions: a. Compare fore-limb (arm) length…
A: Please follow step 2 for detailed explanation.
Q: Human cells have a diploid number of 46. How many chromosomes does a human cell have during anaphase…
A: Cell division is a phenomenon during which splitting of parent cell results in formation of new…
Q: The protein spectrin found in the cortex of red blood cells functions as ______________. Select one:…
A:
Q: Explain the significance of any two historical achievements in proving the role of microorganisms in…
A: Introduction: Bacteria, fungi, and protozoa are examples of biotic microorganisms. Non-biotic agents…
Q: What happens in the cell eventually after signals are transduced?
A: Cells communicate with each other via released proteins unique to each kind. Cell signaling can be…
Q: In Ullrich et al. (2022), the authors describe that the different Covid variants have "missense"…
A: Mutation is any change in the DNA sequence that can altered the final gene product. In some cases…
Q: How is anaphase of mitosis different from anaphase I of meiosis?
A: Introduction :- The fourth stage of mitosis, known as anaphase, divides the duplicated genetic…
Q: Explain how metaphase of mitosis is different from metaphase I of meiosis.
A: There are two types of cell divisions which are involved in the distribution of genetic material…
Q: rovide a formal name for a microorganism that has not been cultivated in isolation? What kind of…
A: Is it possible to provide a formal name for a microorganism that has not been cultivated in…
Q: 6. What do you see in the structure of cellulose that tells you why "fiber" is listed on nutrition…
A: Ans: Cellulose is the structural component of the plant cell wall and found abundantly in the…
Q: List five (5) factors affecting fixation of the cells in a physical and chemical state
A: Fixation: Fixation is a procedure in which cells or tissue are fixed partially in a chemical and…
Q: Below is a set of data for a serial dilution/plate count experiment. Based on this data what is…
A: There are numerous methods/techniques for counting the number of bacteria in a particular sample. A…
Q: You are studying a population of 1000 skunks (which are diploid). You sample alleles at two genetic…
A: Given information There are 1000 skunks that are diploid. A gene has two alleles A and a which are…
Q: What are lacteals? Which digested materials do they absorb? The small intestine produced many…
A: Lacteals are the lymphatic capillaries in the villi of small intestine which absorbs digested and…
Q: Large intestine 1. How long is it ?Which segments make up the large intestine? Which foods are…
A: Introduction: The lengthened, tube-like organ with interconnection to the anus and small intestine…
Q: 25. ATROVENT Nasal Spray contains 0.03% of ipratropium bromide in a 30-mL me- tered dose container.…
A: Atrovent (ipratropium) is a medication used to help control mild chronic obstructive pulmonary…
Q: Describe the methods used in the laboratory diagnosis of the following: a. syphilis b. relapsing…
A: Syphilis The most common way that syphilis is transmitted is through sexual interaction. Usually, on…
Q: The process of myelination results in an increase in white matter. Myelination happens for all brain…
A: Oligodendroglia generate myelin sheaths that cover all over the axonal region of nerve cells as…
Q: 12) The following pedigree is for a rare human disorder. Based on the pedigree, is the pattern best…
A: A pedigree chart is a graphic that depicts the incidence and manifestation of phenotypes (phenotypic…
Q: An existing method for the treatment of spinal abnormalities is the braces method. What change can…
A: Spinal abnormalities: A change in the normal structure function or position of the spine is…
Q: (1) Give 3 differences between DNA and RNA (2) Give 2 similarities and 2 differences between…
A: 1) DNA and RNA DNA RNA It is the hereditary and genetic material of cells It is involved in…
Q: How do you compute carboxylation capacity (Vcmax) and what does the value tell you about the plant?
A: Answer: The maximum Rubisco carboxylation capacity, or Vc,max, is a crucial photosynthetic metric…
Q: Ecological impact for land cover ,
A: The land cover is the surface components of a land. Examination of land cover is important for…
Q: explain and proivde anylyses what are the diagnoses and current and potential future treatments for…
A: adenocarcinoma tumors colorectal cancer (colon) can be diagnosed by following tests 1. Blood test-…
How does intercellular co2 (Ci) relate to photosynthesis? Does more light increase or decrease intercellular co2 (Ci)?
Step by step
Solved in 2 steps
- What is the source of oxygen released during photosynthesis (where does it come from and how is it eliminated)?What is the relationship between the energy content of a photon and the wavelength of light? How does the wavelength of light determine whether it will stimulate photosynthesis? How do the absorbance properties of photosynthetic pigments determine the direction in which energy is transferred within a photosynthetic unit?Why does the boundary layer surrounding a photosynthetic organism make it more difficult to exchange CO2 and O2?
- What substances are produced by photosynthesis? Bycellular respiration?In photosynthesis, CO2 carbon atoms are transformed to glucose carbon atoms. (a) Are the CO2 carbon atoms being oxidized or reduced in this process? (b) Do the CO2 carbon atoms move to a higher or lower energy state in this process?What are the roles of NADPH and ATP in the chemical stage of photosynthesis?
- Which molecule is responsible for the absorption of photic energy for photosynthesis? Where is that molecule located in the photosynthetic cells?Does the oxygen released by photosynthesis come from H2O or CO2?How do the light reactions communicate with the dark reactions to regulate this crucial process of fixing CO2 into biomolecules?
- What is the difference between photosynthesis and cellular respiration?What is the overall outcome of the light reactions in photosynthesis? NADPH and ATP molecules are produced during the light reactions and are used to power the light independent reactions. NADPH and ATP molecules are produced during the light reactions, which are used to power the light dependent reactions. Sugar and ATP are produced during the light reactions, which are used to power the light independent reactions. Carbon dioxide and NADPH are produced during the light reactions, which are used to power the light dependent reactions.What is the overall purpose of the light reactions in photosynthesis?