AP_Bio_Lab_9_RE_Analysis (1)

.pdf

School

Indiana University, Bloomington *

*We aren’t endorsed by this school

Course

L112

Subject

Biology

Date

Apr 25, 2024

Type

pdf

Pages

Uploaded by DeanDangerRaccoon25 on coursehero.com

AP Bio Lab 9 Restriction Enzyme Analysis Modified Lab Report I am modifying the requirements for this lab. You DO NOT have to turn in a formal lab report. Please complete the following lab sheet as an informal lab report. Pre-Lab Activity To prepare for the following lab, it is important for you to have a good understanding of restriction enzyme analysis. Review the relevant information in the content, sidebar, and in your textbook. Materials (all parts) ● Laboratory Investigations Notebook ● Metric ruler Instructions: This investigation consists of several activities, some of which have been altered for you to conduct this lab at home. Make sure you understand both the prepared and modified procedure. Begin by reading over the entire lab (p. 111-124) very carefully and then create investigative ideas that can be tested by experimentation. Activity I: Restriction Enzymes Instructions Read “Activity I: Restriction Enzymes” on p. 113 in your lab manual. Analysis Questions : 1. What is the sequence of the complementary DNA strand (draw it directly below the strand)? 5’-AAAGTCGCTGGAATTCACTGCATCGAATTCCCGGGGCTATATATGGAATTCGA-3’ 3’- TTTCAGCGACCTTAAGTGACGTAGCTTAAGGGCCCCGATATATACCTTAAGCT-5’ 2. Assume you cut this fragment with the restriction enzyme Eco RI. The restriction site for Eco RI is 5’-GAATTC-3’, and the enzyme makes a staggered (“sticky end”) cut between G and A on both strands of the DNA molecule. Based on this information, draw an illustration showing how the DNA fragment is cut by Eco RI and the resulting products. Activity II: DNA Mapping Using Restriction Enzymes Instructions Read “Activity II: DNA Mapping Using Restriction Enzymes” on p. 114-115 in your lab manual.

Analysis Questions : Consider your classmates. More than 99% of your DNA is the same as their DNA. The small difference is attributed to differences in your genetic make up, with each person having a genetic profile or “fingerprint” as unique as the ridges, arches, loops, and grooves at the ends of his or her fingers. (Be sure to justify your predictions below.) 1. Based on this information, can you make a prediction about the products of DNA from different sources cut with the same restriction enzymes? If DNA from different sources are cut with the same restriction enzymes then the resulting RFLP patterns may be different. 2. Will the RFLP patterns produced by gel electrophoresis produced by DNA mapping be the same or different if you use just one restriction enzyme? Even with one restriction enzyme, differences in DNA sequences can still lead to distinguishable RFLP patterns. However, Multiple restriction enzymes provide a better view of genetic variation. 3. Do you have to use many restriction enzymes to find differences between individuals? Using multiple restriction enzymes can enhance the ability to detect genetic variations between individuals however it is not always necessary. 4. Can you make a prediction about the RFLP patterns of identical twins cut with the same restriction enzymes? Identical twins share the same DNA sequence, so their RFLP patterns, when cut with the same restriction enzymes, would be identical. There would be no differences in the fragment lengths between them 5. How about the RFLP patterns of fraternal twins or triplets? Fraternal twins or triplets do not share identical DNA sequences, as they develop from separate fertilized eggs. Therefore, their RFLP patterns, when cut with the same restriction enzymes, would likely be different. Activity III: Basic Principles of Gel Electrophoresis Inv. 1 – Gel Electrophoresis Instructions Read “Activity III: Basic Principles of Gel Electrophoresis” p. 115-122. To complete this part of the lab, you will complete a modified version by using a virtual lab from the Genetic Science Learning Center. The procedures in the virtual lab are the same as the directions provided on pages 116-119 of your student manual, make sure you review both the lab and manual carefully to ensure thorough understanding. Procedure Complete the following virtual lab activity and answer the corresponding analysis questions: Gel Electrophoresis . Analysis Questions 1. What 6 items did you need to prepare your gel? Powder agarose, buffer, a flask, a gel mold, and a gel comb. 2. What is the purpose of the buffer in the electrophoresis box? The purpose of the buffer is to allow electrical charges flow through the gel. 3. What is the purpose of loading the DNA size standard (also known as a ladder)? The purpose of loading the DNA size standard is to determine old fragments that provide a reference. 4. What is the charge of DNA? DNA is negatively charged. 5. Why do you need to put wells on the negative side of the electrophoresis box? Since opposing sides attract, when the current is turned on the DNA will move along the gel towards the positive. 6. When you start electrophoresis, what do you look for to start to appear in the buffer that give you proof that the current is running? You should look for bubbles to form in the buffer. These signal that the current is flowing. 7. What is the purpose of using ethidium bromide or other similar solutions? Using solutions like ethidium bromide helps visualize the DNA fragments.

8. In the picture below draw in your DNA sample bands and give your estimate for bp size using the standard as a guide: Inv 2 – Calculating Size of Restriction Fragments Instructions To complete your analysis, read the directions beginning on page 120 of your student lab manual. Examine the ideal digest below (also on page 121). Using the ideal gel shown in Figure 5, measure the distance (in cm) that each garment migrated from the origin (the well). ( Hint : For consistency, measure from the front end of each well to the front edge of each band, i.e., the edge farthest from the well.) Enter the measured distances into Table 1. (See * and ** notes below the table for an explanation for why there are only six bands seen but more fragments.)

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version