Your PhD thesis advisor has given you the task of preparing a human genomic DNA library. 3a. How will you prepare DNA fragments from the human genomic DNA for use in construction of this library assuming that you want the insert sizes to be about 20000bp in size?
Q: A microbiologist discovers a new type II restriction endonuclease. When DNA is digested by this…
A: Restriction enzymes are also known as molecular scissors because they cut the DNA at specific, short…
Q: A researcher has isolated a restriction endonuclease that cleaves at only one particular 10-…
A: Restriction endonuclease is an enzyme which cleaves DNA into fragments at specific location sites…
Q: What is the role of di-deoxy DNTPs in a Sanger sequencing reaction? Please select the answer that…
A: Sanger sequencing is a method which helps in termination of chain and determining the nucleotide…
Q: Your graduate advisor asks you to amplify the following sequence of DNA by PCR:…
A: The primer should be complementary to the region of template to be amplified.
Q: 5. 2) Digestion of a 1.1kb fragment of plasmid DNA with BamHl produces two fragments of 700 bp and…
A: BamHI is a type II restriction endonuclease can identify specific restriction site and induce cut on…
Q: In a Sanger DNA sequencing reaction (dideoxy method) you use the primer 5′-GCATATA-3′ to sequence a…
A: Sequencing of DNA refers to the biochemical methods for determining the order of the nucleotide…
Q: Figure 9-22 shows the first steps in the process of making a DNA microarray, or DNA chip, using…
A: A DNA microarray is also known as the DNA chip, is the high throughput method that is used to trace…
Q: What is Simple sequence repeat?
A: The genome of every individual contains millions of genetic variation or variants which make each…
Q: Below is a sequence of DNA.…
A: The process of identifying the coding region and the position of a gene in a genome is known as gene…
Q: What was the function of each solution or step in the DNA purification protocol? The following…
A: Deoxyribonucleic acid extraction is the isolation and purification of DNA from sample using a…
Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…
A: The central dogma is DNA --> mRNA --> Protein. Hence, any mutations in the DNA lead to changes…
Q: In addition to the standard base-paired helical structures, DNA can form X-shaped hairpin structures…
A: Cruciform DNA is a form of non-B DNA that requires at least a 6 nucleotide sequence of inverted…
Q: You are analyzing the region of DNA shown below to determine how many AATG repeats are present. To…
A: In PCR, forward and reverse primers are to be added. PCR involves denaturation, annealing and…
Q: 100 50 10 1 10 10 Cot DNA renaturation curves occasionally show three distinct phases of rena-…
A: The denatured DNA can reformulate hydrogen bonds between complementary single strand, making it…
Q: You have received a dehydrated sample of DNA primer at a concentration of 19.9 microM. what volume…
A: Asked : Volume (in microL) of buffer to get a solution of 100nM primer from 19.9 microM dehydrated 1…
Q: The partial sequence of one strand of a double-stranded DNA molecule is…
A: Restriction endonucleases are the enzymes used in genetic engineering or DNA cloning in which…
Q: Even in automated sequencing, where you can include all 4 ddNTPs in one reaction, you need to…
A: DNA sequencing is used to determine the exact arrangement of the nucleotide bases adenine (A),…
Q: True or False. In a comparison between the DNAs of related organisms such as humans and mice,…
A: Conserved sequences in related organisms are compared by comparing their proteins.
Q: Human genomic libraries used for DNA sequencing are often made from fragments obtained by cleaving…
A: Genomic Libraries are a set of collections of genomic DNA data particular to a species/organism. The…
Q: That's the result of Gel electrophoresis of genomic DNA ( Of genomic DNA extraction experiment),…
A: Agarose gel electrophoresis is mainly used for nucleic acid separation due to its large pore size…
Q: The sequence of the 15 bp fragment from the previous problem is repeated below: 5' TCTGAATTCCGTAGA…
A: DNA is a double-stranded molecule that is made of several nitrogen base pairs. The nitrogen base of…
Q: Compare the structural features that distinguish B-DNA from A-DNA and Z-DNA. What is known about the…
A: DNA is the genetic material in almost all organisms with the exception of RNA viruses. DNA exists in…
Q: Calculate the length of the DNA of bacteriophage lambda that has 48502 base pairs.
A: Introduction: DNA stands for deoxyribonucleic acid and is a form of nucleic acid. Except for a few…
Q: In the Sanger (dideoxy) method for DNA sequencing, a small amount of a dideoxynucleoside…
A: Sanger sequencing, also termed chain -terminator sequencing process is based on the ability of the…
Q: The E. coli genome contains 1009 Chi sequences. Do these sequences occur at random, and, if not, how…
A: Recombination is the process of genetic reshuffling where the genetic material is shared within or…
Q: What is the length in basepairs of these sequences? How many base substitutions are there between…
A: The multiple sequence alignment (MSA) involves the alignment of three or greater than three…
Q: If you ran the amplicon from the previous question (so it's about 3.7k basepairs long), on a gel,…
A: Agarose gel electrophoresis is a visualization tool that separates DNA molecules, based on their…
Q: Determine which primer pair is the best choice. • Explain why the other primers are not good…
A: A brief DNA or RNA sequence serves as the template and controls the production of a complementary…
Q: Why do we need to add “COLD” alcohol? What is the effect of the temperature of the alcohol in the…
A: DNA is extracted from various sources to study the sequence of the DNAs from various sources and to…
Q: What is the real definition of DNA ligase to make it true
A: In DNA replication, an enzyme called DNA ligase is used during cell division. After the primer is…
Q: If the DNA duplex for the beta chain of haemoglobin represented by the sequence…
A: Given the template strand in transcription unit is 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5' If the…
Q: The following gel was produced in manual DNA sequencing. What would the unknown DNA template be that…
A: Answer :- In Sanger manual sequencing, DNA of interest is amplified along with dye-labeled chain…
Q: The genetic đistance between DNA sequences 1 and 2 is what value?
A: Genetic distance : Distance between loci are determined by the frequency with which recombination…
Q: The average of a number of closely related but nonidentical sequences is referred to as a(n)…
A: Homologous sequence
Q: In reversible terminator sequencing, how would the sequencing process be affected if the…
A: The basic between sanger's sequencing and reversible terminator sequencing is that Sangar's based on…
Q: Variable number tandem repeats (VNTRs) are repeating DNA sequences of about 15–100 bp in length,…
A: Forensic science. Criminological science is the use of science to criminal and common laws,…
Q: In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into…
A: Genome of an organism includes all the cellular DNA of the organism; including nuclear, chloroplast…
Q: Assume 2x108 reads of 75 bps long are obtained from a next-generation sequencing experiment to…
A: Next-generation sequencing relies on the continuous sequencing of the genome parts and later…
Q: Your advisor, a brilliant bioinformatician, has high regard for your intellect and industry. she…
A: Introduction A genome is consists of transcriptionally active genes. These genes form mRNA as they…
Q: Assume the sequence below is one half of a double stranded DNA template used in a PCR reaction. The…
A: Primers are short sequences of single stranded polymer that mark each ends of the target sequence. 2…
Q: Describe the theoretical structure for deoxyribonucleic acid. Specifically, describe the attributes…
A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…
Q: A section of DNA composed of 4750 nucleotide pairs is found to code for 573 amino acids. Calculate…
A:
Q: Approximately how many Okazaki fragments are synthesized in thereplication of the human genome?
A: Okazaki fragments are short sequences of DNA nucleotides, which is synthesized during replication…
Q: What is a processive enzyme? Explain why processivity is an important feature of DNA polymerase.
A: Enzymes are substances produced by living organisms to carry out reactions at a high rate without…
Q: What feature of the –10 sequence makes it easy to unwind?
A: Pribnow box, or -10 sequence represents the six-nucleotide-sequence TATAAT. This sequence is a…
Q: All the DNA extraction protocols suggest adding salts to the extraction buffer. What is the role of…
A: * Dna extraction can be done in following steps Breaking cells to release the DNA Separating DNA…
Q: A student is running gels to sequence a DNA fragment as below. In addition to running four…
A: Sanger's sequencing method. It is a method based on DNA synthesis. In normal DNA synthesis,…
Q: What are the similarities and/or differences between interpreting Multiple Sequence Alignment (MSA)…
A: Multiple sequence alignment (MSA) is the process or outcome of aligning three or more biological…
Your PhD thesis advisor has given you the task of preparing a human genomic DNA library.
3a. How will you prepare DNA fragments from the human genomic DNA for use in construction of this library assuming that you want the insert sizes to be about 20000bp in size?
Step by step
Solved in 2 steps
- In Polymerase Chain Reaction (PCR), the temperature is one of the most important parameters that could influence the efficiency of this technique. Each cycle of this reaction has its own specific temperature. For instance, the denaturation step possesses a temperature of 94 - 98 ℃ to ensure that the double stranded DNA is fully separated. (i) (ii) (iii) Why is the annealing temperature vital in this technique? Explain how will this temperature affects the efficiency of this reaction. Why is Hot Start PCR technique preferred by some researchers? If the primers you purchased possessed the following information. 5'-GGA AAC AGC TAT GAC CAT G-3' Calculate the melting temperature of this primer and estimate the annealing temperature of this primer.1) Which statement below explains the trick in sanger sequencing that produces fluorescently labeled fragments at every length within a fragment? a) When synthesizing a copy of the DNA to be sequenced, a high concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a low concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. b) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled dideoxynucleotides (ddNTPs) are used instead of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. c) When synthesizing a copy of the DNA to be sequenced, a low concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a high concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. d) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled…DNA renaturation curves occasionally show three distinct phases of renaturation. In this graph, DNA renaturation is plotted against C0t (initialconcentration times time of renaturation—essentially a measure of relativerenaturation time). See Figure 21.3.(a) Identify each part of this plot that corresponds to reannealing of (1)unique sequences, (2) moderately repetitive sequences, and (3) highlyrepetitive sequences.(b) Suppose that you cloned a single-copy gene, such as the gene for dihydrofolate reductase (DHFR), into a plasmid vector and subjected it torenaturation analysis. Sketch the curve you might expect.(c) Suppose that you used reverse transcriptase to copy the ovalbumin mRNA and cloned this complementary DNA (cDNA) into a plasmid vector. Would you expect this cDNA to reanneal (1) more slowly, (2) more rapidly, or (3) at the same rate as genomic DNA? Briefly explain your answer.
- Considering DNA sequencing by the Sanger method. It is correct to say that: * A)In the traditional method, radioactively “labeled” primers are used, allowing their visualization in autoradiography. B)In the automated method, a single reaction is performed containing the four “labeled” dideoxynucleotides, each with a different fluorophore. C)In both traditional and automated methods, the fragments are resolved and interpreted according to their ionization state. D)In the automated method, di-deoxynucleotides “labeled” with the same fluorophore are used, thus allowing their interpretation based on graphs of fluorescence emission. E)Sequencing reactions can use mRNA molecules, as long as they have a polyA tail.A student is running gels to sequence a DNA fragment as below. In addition to running four sequencing reactions with the requisite ddNTPs, they also include four ‘mystery’ reactions representing variants of the first sequencing lane (using ddATP to sequence T in the template) in which one or more components of the reaction have been omitted or inappropriately added. Give a possible explanation for the what was inappropriately added/omitted in each mystery lane. Note two important things: firstly, even if everything works perfectly there is still always some unextended primer in a reaction. Secondly, there may be more than one possible explanation for some lanes; just give one.Figure 9-22 shows the first steps in the process of making a DNA microarray, or DNA chip, using photolithography. Describe the remaining steps needed to obtain the desired sequences (a different fournucleotide sequence on each of the four spots) shown in the first panel of the figure. After each step, give the resulting nucleotide sequence attached at each spot.
- 31.) The following DNA fragment was sequenced by the Sanger method. The asterisk indicates a fluorescent label. *5'------3'-0H 3'------ATTACGCAAGGACATTAGAC---5' A sample of the DNA was reacted with DNA polymerase and each of the nucleotide mixtures (in an appropriate buffer) listed below. Dideoxynucleotides (ddNTPs) were added in relatively small amounts. Lane 1: DATP, dTTP, dCTP, dGTP, ddTTP Lane 2: DATP, dTTP, dCTP, dGTP, ddCTP Lane 3: DATP, DTTP, dCTP, dGTP, ddATP Lane 4: DATP, dTTP, DCTP, dGTP, ddGTP The resulting DNA was separated by electrophoresis on an agarose gel, and the fluorescent bands on the gel were located. The band pattern resulting from nucleotide mixture 1 is shown below. Assuming that all mixtures were run on the same gel, what did the remaining lanes on the gel look like? ( Fill in the gel below.) 3 Electrophoresis Il||Q.)The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 109 In your answers, show how you came up to each result? (a) How many base pairs does this bacterium contain? (b) How many full double-helical turns does this DNA contain? (c) How long is this DNA in mm?The chain terminator method was used to sequence the following DNA fragment: ACTGGGCATAAGCGGGAACTTTGCAGAACTGGCTGGCCTCAGAGCAGGGA. 1. Predict a band pattern in a gel after sequencing this DNA fragment using a radioactively labeled primer [32P]-5’- TCTGAGGCCAGCCAGTTCTGCAAAGTTC. 2. Due to an experimental mistake, dATP was not added in all four reaction mixtures. How does the band pattern change?
- 1a) When performing classical Sanger or "dideoxy" sequencing, you set up 4 parallel reactions per template to be sequenced from a specific primer, with each of the four reactions containing a different dideoxynucleotide, and then the four reactions were run in a separate, adjacent lanes on a gel. Why couldn't you combine all 4 dideoxynucleotides with the primer and the template and do the whole reaction in one tube, and then run the set of fragments produced by the reaction mixture on a single lane in an acrylamide gel?The short DNA shown below is to be sequenced. Using your knowledge of how the Sanger method works, in the gel diagram, draw in the bands that will appear when DNA polymerase is added to the reaction along with the four different nucleotide mixtures indicated. Note that some of these mixtures are not what would normally be used in a sequencing reaction. Dideoxynucleatides (ddNTPs) are added in relatively small amounts. The asterisk represents a radioactive label. *5' - 3'-ОН 3' – -- ACGACGCAGGACATTAGAC-5' Nucleotide mixtures: A. DATP, DTTP, dCTP, DGTP, ddTTP (given) B. DATP, ATTP, dCTP, AGTP, ddATE C. dTTP, dGTP. ACTP, ddCTP, ddATP D. DATP, dCTP, dTTP, ddGTP A в с D | || ||1) What happened to the DNA at the different temperatures? How does Polymerase Chain Reaction exploit this property of DNA (Word count: 200) 2) Briefly outline the steps of DNA extraction as carried out in a lab for the purposes of sequencing, with reference to a published protocol from a company that supplies regents and kits for DNA extraction (e.g Qiagen, ThermoFischer, Invitrogen, or similar). Please Include the weblink for the published protocol you used as a reference