Write the mRNA sequence that remains after the deletion. Use the codon table to write the sequence of amino acids that would be translated after the deletion. How does the deletion change the protein that is produced?
Q: Even in the absence of genetic recombination, meiosis is an important source of genetic variation in…
A: INTRODUCTION Genetic variation refers to differences in some of the genomes of members of identical…
Q: Discuss the following statement: “from the nucleotide sequence of a cDNA clone, the complete amino…
A: The proteins are the polymer of amino acids. They play an important role in the cell, by catalyzing…
Q: Which of the following assays would utilize monoclonal antibodies? MRI imaging of mice expressing…
A: Antibodies are proteins that are secreted by specialized white blood cells called B lymphocytes or B…
Q: Figure la and 1b show two protein gels (SDS-PAGE) in which human blood serum has been…
A: Although many conditions can cause an increase in the gamma region, several disease states cause a…
Q: . What are the three principles of the theory of evolutionby natural selection?
A: Introduction :- Evolution refers to the change in a species' characteristics over several…
Q: Identify the biomarkers used for Giant cell tumour.
A: A biomarker is considered to be a molecule found in the blood, or other body tissues that symbolizes…
Q: Which of the following structures are associated with the ends of chromosomes and may shorten over…
A: Chromosomes are thread like structure made of a single molecule of DNA associated with proteins.…
Q: ile other photons of visible light are reflected. Explain what is happening in a ment molecule at…
A: The band of colour in the sunlight which is visible is included in the visible spectrum. It is…
Q: oviposition for
A: Oviposition means expulsion of the egg from the oviduct to the external environment. eggs or female…
Q: connection and correlation is there between the red-shouldered hawk, the pacific madrone, and the…
A: NOTE: Please note that as per our company's honor code, citing external references is not allowed.…
Q: Given that the AG" values for the hydrolysis of glucose 1-phosphate and glucose 6-phosphate are…
A:
Q: Match the concept in column A to the concept in column B. Write the letter of the correct answer on…
A: Ans: Amino acids are C - terminus and N -terminus. 2. In endoplasmic reticulum, attachment of…
Q: A cell membrane with no proteins will still show which process? a) active transport b) facilitated…
A: Introduction :- The cell membrane, also known as the plasma membrane, separates the interior of the…
Q: Which is the odd man out based on the third appendage? Asiomorpha, Tachypleus, Menalaides, or…
A: An appendage (or outgrowth) is an external body part, or natural prolongation, that protrudes from…
Q: Identify the scientific name of the following gastropods
A: INTRODUCTION Gastropod, any of the more than 66,000 animal species that make up the Gastropoda…
Q: A change in the open reading frame that results in a different protein sequence is called a…
A: Introduction :- A mutation is a change in an organism's DNA sequence. Mutations can occur as a…
Q: What are the components of the initiation complex for translation
A: Translation is a process in which codon of mRNA code for specific amino acid. These amino acid…
Q: Justify why algal biotechnology has the potential to be the future of climate change mitigation
A: Algae can help combat climate changes by removing CO2 from the atmosphere, storing it as biomass,…
Q: Female Drosophila with cinnabar eye (cn) and vestigial wings (vg) were mates to males with roof…
A: "Inheritance" is the process through which a child gets genetic information from his or her parents.…
Q: 6. In molluscs.the umbones are other. when they face each a. prosogyroUs b. opisthogyrous c.…
A: Mollusca is the second largest invertebrate animal phylum after Arthropoda, and its members are…
Q: hair, underdeveloped nails, and abnormally shaped eyelids. In the following pedigree, which…
A:
Q: in not more than 5 sentences a. The lock and key model for enzyme activity b. Relationship of…
A: a. Each enzyme is built in a certain way to help with a specific process. This implies that there is…
Q: 3. BPA is a chemical compound that was used in the manufacturing of plastic. When it comes into…
A: DISCLAIMER Since you have asked multiple questions, we will solve the first question for you. If you…
Q: 7) The protein VEGF plays an important role in stimulating the formation of new blood vessels. In…
A: VEGF ( vascular endothelial growth factor ) is responsible for the growth of new vessels. In…
Q: Explain why the lungs of a frog is underdeveloped
A: Frogs depend on their lungs to inhale when they are dynamic and need more oxygen than skin breath…
Q: You will be visualizing fluorescently labelled clathrin in this lab. How is the clathrin labelled…
A: Clathrin is a protein that plays a major role in the formation of coated vesicle . this term was…
Q: The mineral ion needed for the formation of blood clot is : (A) Potassium (B) Sodfrym (C) Calcium…
A: Introduction :- A blood clot can be caused by anything that prevents your blood from flowing or…
Q: Which part of the bone makes red blood cells? Cancellous/Spongy Bone O Trabeculae O The Marrow…
A: Red blood cells are the most common type of blood cells present in blood and it is the principal…
Q: In eukaryotic gene regulation, the Mediator complex mediates interactions between: The preinitiation…
A: Mediator complex found in Drosopila , mammals and yeaat. It interact with transcription factor…
Q: The 1918 influenza strain killed millions of people world-wide. After recovering virus from…
A: The influenza virus, which infects the respiratory tract, causes influenza. The influenza virus is…
Q: It has been claimed that “evolution repeats itself.” Whatis the evidence for this claim froma. the…
A: Evolution is the process of change in a population of organisms over time. This can be caused by…
Q: The cell organelle peroxisome a) contains oxidase enzymes b) adds carbohydrate chains to proteins C)…
A: Peroxisomes are small membrane-enclosed organelles that contain enzymes involved in a wide range of…
Q: C. The patient has a pneumonia infection in both lungs. a. Place the patient on bed rest and…
A: Pneumonia is a typical problem that influences a huge number of individuals every year. Germs such…
Q: Which of the following statements concerning the evolution of behavior is correct? A. Natural…
A: Behavioral evolution can include sensory system alterations, brain changes, and even physical…
Q: 2. What is the main difference between the following organisms: strep, aids, polio, measles, and…
A: INTRODUCTION Virus This is the small microscopic infectious agent which can multiply only inside a…
Q: Compare the structure and roles of the lymph node and the spleen in the immune system.
A:
Q: (a) Compare and contrast some of the different mechanisms used by pathogens to establish an…
A: Pathogens are any microbes that can cause infection and diseases in plants and animals. The…
Q: Are AS heterozygotes completely resistant to malarialinfection? Explain the evidence for your…
A: Malaria is a parasitic disease spread by mosquitoes. Humans are infected with the parasite after…
Q: If a stretch of mature mRNA to be translated has 300 bases, the resulting peptide will have O 300…
A: Amino acids are chemical molecules that contain the functional groups amine (NH2) and carboxyl…
Q: The PCR process has 4 steps :collection, preparation, amplification, and post PCR clean-up. The PCR…
A: PCR stands for Polymerase Chain Reaction. PCR is a technique used to rapidly amplify specific…
Q: Tell five (5) facts about respiratory system
A: The respiratory system is the organization of organs and tissues that assist you with breathing. It…
Q: Is biotechnology always associated with genetic engineering? Explain your answer
A: Biology is a vast area which is divided into many sub branches such as Biotechnology, Biochemistry,…
Q: 9. Why are new strains of Influenza more problematic?
A: Influenza is a acute respiratory disease which arises from zoonotic animals like bats and aquatic…
Q: NO NEED TO EXPLAIN, JUST GIVE THE ANSWER An allele is __________ if its effect masks that of a(n)…
A: Introduction Allele:- An allele is a variant form of a gene or it is one of two or more versions of…
Q: correct
A: Telomeres are present at the end of the chromosome strand and these are the repeated DNA sequences…
Q: 1. ionosphere 2. lithosphere 3. troposphere 4. magnetosphere 5. stratosphere
A: The atmosphere is divided into many layers depending upon the availability of air, intensity of…
Q: If the parents have blood types that are both AB-, which children are likely?
A: Introduction :- Blood types are determined by the presence or absence of antibodies and inherited…
Q: FOR DIRECT MEASUREMENT OF THE RELATIVE AIR HUMIDITY USE THE APPLIANCE 1. psychrometer 2. barometer…
A: The quantity of water vapor in the air is known as humidity. The humidity would be high in case of…
Q: (1) A plant cell may burst when: (A) Turgor pressure equalises wall pressure. (B) Turgor pressure…
A: Introduction - Plant cells are eukaryotic, meaning that they have their own nucleus. Plant cells are…
Q: Fill in the following with the correct words about cloning (the first blank will be the first word…
A: Cloning In simple terms, the term cloning is derived from the word "clone" which means "exact copy",…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- 1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence. 2. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. Assumption is that the first amino acid is the N-terminal. 3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. The assumption is that the first amino acid is the N-terminal.1. Given the piece of MRNA: 5'-CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC-3' 1. Predict the DNA strand sequence from which it was transcribe 2. List the complementary non-coding DNA Sequence 3. List the Amino acid Sequence of the protein coded for. Use the Genetic Code 2. Below is a short segment of a DNA molecule. Translate the DNA codon into MRNA. 5'- TACCATGAGAATTGTGG TCACCTTTTT-3' 3'- ATGGTACTCTTAACACCAGTGGAAAA A-5' MRNA Sequence Amino Acid Sequence11. The segment of DNA below contains three exons and two introns. The length of each section is as follows: Exon 1: 90 base pairs Exon 2: 110 base pairs Exon 3: 70 base pairs Intron 1: 180 base pairs Intron 2: 120 base pairs Initiation Site Intron 1 Promoter Exon 1 Intron2 Exon 3 Termination Site A. How long will the coding region of the processed mRNA transcript be? (Remember that stop codons are indeed transcribed into mRNA.) B. How many amino acids will be included in the translated protein? (Careful!) X PolyA site Exon 2
- 4. Compare the DNA sequences of individuals with Alzheimer's disease and their family members. Two codons in the APP gene sequence are different in the two patients with Alzheimer's disease compared to individuals without the disease. Consider the first codon that's different and complete the table below. Codon in Codon in Amino Acid DNA template strand MRNA APP gene in individuals without Alzheimer's disease APP gene in individuals with Alzheimer's disease Does the change in this codon represent a silent or a missense mutation? Explain.1. A portion of the template strand of a DNA molecule that codes for the 5'-end of an mRNA has the following nucleotide sequence. Give the primary structure of the polypeptide (use 3-letter amino acid codes), beginning with the most common translation initiation codon, that will be specified by this portion of the gene. Be sure to label the ends of the polypeptide. 3'-TTTTACGGGAATTAGAGTCGCAGGATG-5'16. Consider the following original coding sequence of a gene that codes for a short 3-amino acid polypeptide: 5'-ATGTGGTCATGA-3' Using the genetic code and the amino acid table below, which of the following sequences arises from a non-conservative missense mutation in the original sequence shown above? First base in codon U A UUU UUC- UUA UUG- CUU CUC CUA CUG- AUU- ACU AUC Ile (1) ACC AUA- ACA AUG Met (M) start ACG GUU GCU GUC GCC GUA GCA GUG- GCG H₂N- U Phe (F) Leu (L) Leu (L) Nonpolar side chains; hydrophobic Val (V) Side chain (R group) H H₂N-C-C-0- HO Glycine (Gly or G) CH₂ H₂N*- CH₂ CH₂ H O Methionine (Met or M) Polar side chains; hydrophilic 0 CH₂ Second base in codon H O Aspartic acid (Asp or D) UCU UCC UCA UCG CCU CCC CCA CCG Alanine (Ala or A) OH CH₂ H₂N-C C 0 H₂N-C C 0 H O Serine (Ser or S) H O Threonine (Thr or T) Electrically charged side chains; hydrophilic OH CH3 CH -0- H₂N+- Acidic (negatively charged) CH₂ H₂N-C-C-O HO C Ser (S) Pro (P) CH₂ CH₂ Thr (T) CH₂ H₂N-C Ala (A)…
- 1. Create a DNA sequence with eighteen nucleotides. Indicate its 3’ on the left and 5’ on the right since that’s the template strand you will need in the next question to transcribe the mRNA. 2. Transcribe the DNA sequence above and separate the triplets into codons. Indicate 5’ and 3’ in the correct location on the strand. (Don’t worry about splicing- assume that the pre- mRNA is the same as the mature mRNA sequence) 3. Look at the genetic code, and indicate which amino acid is coded for by the codons in the above mRNA. 4. ANSWER BELOW QUESTIONS: A. First write the original DNA strand. Indicate where the substitution was by either circling it or writing it in a different color. Then write the mutated DNA sequence with the point mutation (aka substitution) wherever you choose for it to be. Again, circle it or write it in a different color. Do the same for the transcribed mRNA. Repeat the directions for 2 and 3 for this new DNA stand. (i.e., include the mRNA and translated protein…1. Given the anticodon in tRNA is CUU, name the amino acid that will be added. 2. Given the anticodon in tRNA is CUU, what is the complementary codon? 3. How many synonyms code for arginine? 4. How many codons code for the amino acid cysteine? 5. How many codons code for the amino acid histidine? 6. How many codons code for the amino acid threonine?8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for creating the mRNA. Write the corresponding mRNA 5' 3' and translate this mRNA into protein. DNA 3' CCGTGAATACGCTACGGAACTCACTGGTA 5' DNA 5' GGCACTTATGCGATGCCTTGAGTGACCAT 3' mRNA 5' Protein Aline Valine Arginine partic Lysine Asparagine COTOCOAQUC. C FOU U G A Glycine Threonine A GUC A GU G Stop Step Cysteine GTryptophan Phenyl- sarine Lauche C Serie CROUCH UG A C U Hatidine Tyrosine 2060 20/ Leucine Proine
- 6. Similar to the class notes (Intro to Genetics), a segment of DNA (shown below) contains a promoter segment (the first 9 base pairs), a ribosome binding segment (the next 6 base pairs), and a segment that codes for protein synthesis which is started by the rest of the base pairs. ACTCCATTGAACCATTTCTATGATCCGCTAACG-... TGAGGTAACTTGGTAAAGATACTAGGCGATTGC-... A. When the DNA is induced to be copied to mRNA, the top strand is coding, meaning that the mRNA makes an identical copy of the lower strand (replacing T with U) The mRNA copy starts with the ribosome binding sequence. What is the sequence of the mRNA that will go to the ribosomes? B. What are the first 6 amino acids of the protein that are coded for by the mRNA? C. What would the amino acid sequence be if... i. a transition mutation occurred on the final G in the mRNA? ii. all of the G & C bases in the protein synthesis portion had transition mutations? iii. a point deletion mutation occurred in the ATA sequence (in the lower strand…1. The following is the DNA sequence of a gene: 3' TACTAACTTAGCCTCGCATC S' a. What amino acids are coded by this sequence? b. An adenine is inserted in this strand after the first guanine from the left. The resulting polypeptide is six amino acids long. Where is the newly produced nonsense codon located? What is the amino acid sequence in the fragment?16. Consider the following original coding sequence of a gene that codes for a short 3-amino acid polypeptide: 5'-ATGTGGTCATGA-3' Using the genetic code and the amino acid table below, which of the following sequences arises from a non-conservative missense mutation in the original sequence shown above? First base in codon U C A G UUU UUC- UUA UUG- H₂N+ H H₂N-C- Phe (F) CUU- CCU CUC CCC CUA CCA CUG- CCG AUU ACU AUC Ile (1) ACC AUA ACA AUG Met (M) start ACG- GUU GCU GUC GCC GUA GCA GUG- GCG Nonpolar side chains; hydrophobic Leu (L) U Side chain (R group) OH CH₂ Leu (L) H₂N-C Val (V) HO Glycine (Gly or G) CH3 S CH₂ CH₂ Polar side chains; hydrophilic H O Methionine (Met or M) 0 H₂N-C Second base in codon UCU UCC UCA UCG OH CH, CH HO Aspartic acid (Asp or D) HO Alanine (Ala or A) 0 H O Serine (Ser or S) HO Threonine (Thr or T) Electrically charged side chains; hydrophilic CH3 H₂N-C-C-0- Acidic (negatively charged) CH₂ H₂N+ C CH₂ CH₂ H₂N-C-C-0- H₂N-C- C CH₂ Ser (S) Pro (P) Thr (T) H O…