Which of the following is the densest TAG? Otrimyristin triolein O tristearin Otripaltristearin mitin
Q: (b) Why does solution pH affect separation of proteins via electrophoresis? (c) With reference to a…
A: Electrophoresis is a technique which enables the separation of proteins. Proteins in the sample get…
Q: Why do you think you need to add NaCl?
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: Which of the following is an inhibitor of gluconeogenesis? Group of answer choices: -ATP -ADP…
A: Gluconeogenesis is the process of Synthesis of glucose from lactose, pyruvate, glucogenic aminoacids…
Q: Make a mind map for cellular respiration
A: Cellular respiration is a process which involve metabolic reactions taking place in cells. These…
Q: Which of the following is an electron carrier that shuttles electrons between various protein…
A: The electron transport chain (Figure 1) is the last component of aerobic respiration. Electron…
Q: Carbohydrates are biomolecules are complex molecules whose building block is the ___________.…
A: Carbohydrates, lipids, proteins, and nucleic acids are the four major biomolecules. All of these…
Q: 4. PFK-1 is tightly regulated with multiple potent allosteric regulators. Name three of these…
A: PFK-1: In the mammalian glycolytic pathway, PFK1 is the most essential regulatory site. This phase…
Q: Which of the following metabolic processes directly involve Acetyl Coa (both as an immediate…
A: Acetyl CoA is intermediate and a product of many metabolic pathways. Acetyl CoA is directly involved…
Q: Which pathways produce NADPH
A: NADPH means nicotinamide adenine dinucleotide phosphate. NADPH is also known as reducing equivalent.…
Q: What enzyme catalyzes the conversion of fructose 1,6-bisphosphate to fructose 6-phosphate? O…
A: In glycolysis, 1 molecule of Glucose is converted to 2 molecules of puruvate. Where in step 3,…
Q: Which of the following statements regarding gluconeogenesis is NOT true: It utilizes all of…
A: Gluconeogenesis refers to the process of synthesis of glucose from non-carbohydrate precursors. It…
Q: Try searching for a way that RNA is used other than for making protein. Does this use involve…
A: Introduction: The structure of RNA is similar to DNA with several key differences. It is made up of…
Q: glycolysis step 7, ATP synthesis occurs through ______. The energy for this reaction comes _____…
A: Glycolysis is the process of oxidation of glucose into smaller molecules.it occurs in two phases as…
Q: 4) The mol- other me complex: importar
A: Molecules like protein became functional only when they fold themselves into the tertiary structure…
Q: Discuss the synthesis and breakdown of glycogen and how the processes are regulated in response xto…
A: Glycogen is a homopolysaccharide. glycogen has α1-4 glycosidic bond in linear eight to ten…
Q: OH HO- CH₂OH OH -CH-CH₂ HO-CH- . CH I NH " CH . C=0 (СН2)12 (CH2 10CH3
A: The given molecule has a polar head group in the form of a carbohydrate or sugar moiety and…
Q: Differentiate saponifiable the two classifications of lipids, and non-saponifiable.
A: Lipids are molecules that are insoluble in water and soluble in organic solvents like ether,…
Q: Convert the Fischer projection to the Haworth projection of the a-furanose form by moving the…
A: The Fischer projections are a standard method for depicting the three-dimensional arrangement of…
Q: A water (H20) molecules is
A: Water occurs as a liquid on the Earth's surface under normal conditions, making it invaluable for…
Q: 1. For one mole of the fatty acid residue, determine the following:
A: The transferring of electrons from electrons Carrier and finally accepting by the Oxygen. The…
Q: Describe the fluid-mosaic model of the cell membrane and how it results in a semi-permeable membrane…
A: The principle function of the membrane is to separate the contents of the cell from the exterior.…
Q: The C4 pathway utilizes less ATP than C3 pathway thus enabling C4 plants to adapt to tropical…
A: C3 and C4 are two different plant photosynthetic pathways found in different types of plants. C3…
Q: Which of the following is not involved in cyclic cyclic photophosphorylation? Group of answer…
A: During photosynthesis the photoexcited electron that is energized by light passes from the primary…
Q: With which of the four complexes in the electron t ransport chains is each of the following events…
A: The electron transport chain receives the NADH and FADH2 generated in the citric acid cycle. The…
Q: Cytoplasm should have a higher concentration of _____ to help glycolysis going. NAD+ ATP…
A: Nicotinamide adenine dinucleotide is a coenzyme plays a central role in metabolism. It is found all…
Q: in every Acetyl CoA entering ETC, how many ATPs are produced?
A: Glycolysis as well as the TCA cycle both are processes involved in cellular cellular metabolism. In…
Q: Total number of FADH2 molecules generated as a result of catabolism of one glucose molecule is…
A: The redox cofactor FADH2, which stands for flavin adenine dinucleotide, is formed during the last…
Q: Draw 3 isomers of C7H12O2 then state where you wil disposal should only be repeated once).
A: Heptanedial is represented by C7H12O2. The molar mass of the given compound is found to 128.2 g/mol.…
Q: Glucagon _____ β-oxidation and _____ fatty acid biosynthesis. Group of answer choices: inhibits;…
A: Beta oxidation: process via which fatty acids are broken down to produce energy.
Q: electron transport chain,
A: The ETC stand for electron transport chain system. It helps to transfer the electron from various…
Q: 6-P Gluconate Ribulose 5-P 6-P Gluconolactone 11 Xylulose 5-P Glucose 6-P 41 Fructose 6-P…
A: The "oxidative pentose phosphate" pathway is also called "phosphogluconate pathway" (also hexose…
Q: Crystal structures exist for three neurokinin-1 (NK1) ligand complexes with the following pdb codes…
A: NK1 is a type of mammalian tachykinin receptors. These are G-protein coupled receptors which are…
Q: An experiment was carried out to measure the reaction rate of hydrolysis of acetylcholme (substrate)…
A: We need to draw the Lineweaver Burk (LB) plot to find out the answers. LB plot has 1/[S] as X-axis…
Q: Which of the following factors favors the formation of the Random DNA Coil? Base-Pairing…
A: Nucleotides are the building components of deoxyribonucleic acid (DNA). Each nucleotide is made up…
Q: Estimate the fragment sizes (bp) of the DNA bands from each sample lane
A: Introduction: In the gel electrophoresis, agarose derived from red seaweed acts as a sieve for…
Q: The macromolecules that serve in the storage and transmission of genetic information are __________.…
A: Biomolecules are the organic compounds produced by living organisms. They are primarily made up of…
Q: Please state if the statements are true or false. 1. A furanose is a sugar in the Haworth…
A: Carbohydrates, often known as sugar molecules, are a type of molecule. Carbohydrates are one of the…
Q: How does time and temperature affect the yield of glycogen during isolation?
A: Glycogen is the storage form of sugars in mammals and many other higher animals. Glycogen is a…
Q: Give the positive result for the test of purines.
A: Purines are the nitrogen bases that are hetero cyclic in which pyrimidine ring is fixed with…
Q: Define the pedigree symbol(s) associated with each of the following individuals. Please be as…
A: Pedigree: Pedigree is a family tree that is used to show the mode of inheritance of genetic traits/…
Q: During Krebs cycle, the conversion of isocitrate to alpha-keto glutarate involves all of the…
A: Isocitrate to alpha-keto glutarate: Via enzyme isocitrate dehydrogenase
Q: Which of the following is not involved in cyclic cyclic photophosphorylation? cytochrome bf complex…
A: Cyclic cyclic photo phosphorylation occurs in thylakoid membrane where the conversion of ADP to ATP…
Q: briefly explain the importance of the protein factor EF-Ts in the translation process. do not simply…
A: EF-Ts is a protein factor used during elongation in prokaryotes. Elongation process in…
Q: Which of the following statements is FALSE? Water is the ultimate electron donor. Photosystem II has…
A: Autotrophs are plants that can use light energy to make their own nourishment. Many people feel that…
Q: II. Provide the chemical formula for each of the following compounds. 1. sodium sulfate 2. sodium…
A: Chemical formulae are a way to represent any chemical compound using the symbols for the components…
Q: 22. The blood group by the MN system depends on the combi- nation of the codominant genes CM and CN.…
A: For the blood grouping by MN system, According to hardy Weinberg equation, a gene that exists as two…
Q: e. Triacylglycerols and glycerophospholipids both contain fatty acids and saponifiable. True False…
A: Triacyl glycerols are the esters of fatty acids attached to Glycerol. GlyceroPhospholipids are…
Q: Acetyl-CoA, AG" = -7.7 kcal/mol CoA Oxaloacetate Citrate AG" = ? AG"=-1.5 kcal/mol Isocitrate Krebs…
A: The tricarboxylic acid (TCA) cycle, or the Krebs or citric acid cycle, is the primary source of…
Q: Please state if the statements are true or false. 1. A pyranose is a sugar in Haworth projection…
A: Pyranoses are sugar molecules having six members. Cytosolic pyruvate kinase catalyzes…
Q: hat are the physiological effects of prostaglandins, explain how aspirin can block the synthesis of…
A: Introduction: Prostaglandins are a group of closely related biologically active lipids, that are…
Step by step
Solved in 2 steps
- Among the following structures, the drug that can be given orally against B-lactamase-producing strain: is: CO-H OCH COOH I COOH II NH2 HO COOH III IV COOH Oll ONone of the above OlI OIVU UUU UAU 11yr Phe UUC UUA Leu UUG Jle UCU UCC UCA UCG UGU UGC Cys UGA Stop UAG Skop UGG Trp UAC Ser UAA Stop CUU CUC CỦA CUG CAU JHis CAC CGU CGC CGA CGG CCC Leu Pro Arg ССА Delete CCA CG CAA CAG JGIN Gln AUU AUC le AUA AUG Met AGU 1 Ser AGC AGA AGGJArg 1. ACU ACC The ACA ACG AAU M AAC AAA AAG Jlys JAun ATG AAC TAC CTA GGG ACA GAU JAsp GAC GAA GAG JGlu GUU GUC Val G GUA GCU GCC GCA Ala GCG GGU GGC Gly ATG ACC TAG GGA CA GGA GGG GUG G. Compare translation before and after the deletion. What effect might it have on gene function? Asp Daspartic acid lleI isolcucine Thr T threonine Leu L leucine Ser S serine Туr Y tyrosine Glu E glutamic acid Phe F phenylalanine Pro P proline His H histidine Lys K Arg R Gly G glycine lysine Ala A alanine arginine Cys C cysteine Trp W tryptophan Val V valine Gln Q glutamine Met M methionine Asn N asparagine Second Position UGU 1Cy UCU UCC Ser UCA UG UUU Phe UAU UAC Ty UAA Slop UGA Stop UAG Slop UGG Trp UGC UUC U UUA Leu ] low UUG CUU CÚC A Leu CCU CCC Pro…Elaborate on the abbreviation RTP. What does it stand for? What is it usedfor?
- What is the name of the fungal toxin that inhibits RNA polymerase Il at 1 microgram/mL concentration? O Flavopiridol a-Amanitin O Triptolide DRB (5,6-Dichloro-1-ß-D- ribofuranosylbenzimidazole)What is the expansion of acronym MICA?Meropenem is a carbapenem antibiotic. Which circle indicates the B-lac tam ring? Please define and explain your answer.
- Why is it not advisable to use adhesive mixtures if protein histological inevstigations are contemplated.Explain what is TFIID ?Download BLOSUM30 and BLOSUMB0 substitu- tion matrices and place them side by side on your computer screen. What are the differences between the two matrices? Why do you see these differences?
- The sequence shown in Figure 2 is the nucleotide sequence of a heat shock protein of Bacillus anthracis obtained from the NCBI database. >NC_005945.1:2107825-2108262 Bacillus anthracis str. Sterne chromosome ATGCGTAATTTATTTCCAGAAATAACAAAACGTCAAAATGGTATTTTTGATTTTGGACCTTCTTTATTAG AAGGGATGACAGATGCTTTCTTTAAACCGATGAACATGGATATTTTTAAAGTAGATGTTCATGAACAATC TGATAAATATACAGTGAAAGCAGATTTACCAGGTTTTCAAAAAGAAAACATTCAAGTTGAATTTGAACAA GATGTATTAACGATTCAAGCAACTAATCATAATGAAGTAGAAGAAAAAAATGAGAATGGCACATATATTC GTAAAGAACGTTCTATAGGTTCTGTAACTCGACGTTTTAGTTTTAAACAAGTTGAGGAAGAAAATGTTAG AGCGAATTACAAAGATGGCGTGTTGACAATTGAATTGCCAAAATTGAAAGAAGAAAAAAACAGTAAAACA ACAATTAATATTGAATAA Figure 2 (i) Is the nucleotide sequence above translatable into a complete protein? Justify your answer. (ii) Is the sequence above represented in the standard FASTA format? Explain your answer.The bases composition of a nucleus acid is: 5t, 6c, 8a, 9g. What is the nature of this nucleic acid? Is it a dsDNA? ssDNA? ssRNA? dsRNA? Explain your choice.Question Image hown bele nallest? Q. A gel from gel electrophoresis is shown below. Which DNA fragment is the smallest? B. Direction of Travel