Which of the following are outputs of the Calvin cycle? Choose all that apply. ATP water carbon dioxide gas ADP+P G3P (precursor to glucose) O NADPH NADP+ oxygen gas sunlight
Q: How is physiological insect defensive mechanisms carried out by the insect circulatory system? Does ...
A: Circulatory system in insects- The circulatory system of insects, like that of all arthropods, is of...
Q: In a parental cross of a ADHL disease trait, where the father is affected and the mother is unaffect...
A: Attention deficit hyperactivity disorder (ADHL) is an autosomal dominant neurodevelopmental disorder...
Q: How will you distinguish b Stem cell from B cell at DNA level
A: B stem cells: it includes pluripotent hematopoietic stem cells that gives rise to multipotent common...
Q: In a true breeding parental cross for an AR disease trait, the expected proportion of offspring in t...
A: True breeding is a sort of breeding in which the parents generate kids with the same phenotype as th...
Q: Use the following choices (not all will be used, but each will be used only once) to fill in the bla...
A: Cell membrane: it is made up of lipid bilayer. It is selectively permeable. It also contains transpo...
Q: Fill in the blank: The shape of a red blood cell is related to its function of
A: RBC is type of blood cell.
Q: How does modification of the insect legs/limbs better equip the insect to survive in a given environ...
A: *NOTE: Kindly repost for other questions. * Dear Student as per the guidelines we are supposed to a...
Q: Which biotic and abiotic factors are different between a lion and a deer?
A: The lion and deer are both important members of the food chain and may coexist in the same area. Lio...
Q: Describe clearly the theory of the origin of the Vertebrata from invertebrates
A: The invertebrate-to-vertebrate transition was a watershed moment in the animal kingdom's history. Ve...
Q: All of the following are true about lipids except A. They store more energy than carbohydrates ...
A: Lipids are a type of macromolecule that contain hydrocarbon. Fats, wax, oil are few examples of lipi...
Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O Phe-Leu-Met-Cys-Arg-Arg-I...
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Tra...
Q: What's the role of Protein Phosphatase 1 (PP1) in cell signaling?
A: Protein phosphatase 1 (PP1) belongs to the protein serine/threonine phosphatases family of phosphata...
Q: Select ALL the structures below that you find ONLY in animal cells, not in plant cells. O mitochondr...
A: A typical animal cell consists of: cell membrane/ plasma membrane lysosomes nucleus nucleolus nucl...
Q: there a risk with measuring a-vO2 difference
A: Answer:
Q: Energy is added products This graph shows an reaction. AG >0 reactants Time Gibbs Free Energy
A: *Endothermic reaction: An endothermic reaction is chemical reaction that absorbs heat from its en...
Q: H,0 H,0 H,0 H,0 H20 H,0 H20 Plasma membrane H,0 Which figure depicts a plant cell placed in a soluti...
A: INTRODUCTION When a cell placed in a hypertonic solution the water will move from the cell to the so...
Q: Refer to the accompanying figure to answer the following question(s). R R EN-C-C-N-C-C-O-H H H А. В....
A: Q. At which bond would water need to be added to achieve hydrolysis of the peptide, back to its comp...
Q: Did Steve Job's cancer metastasize during the nine months he tried holistic treatments rather than s...
A: Steve Job,the co-founder of Apple Inc.,had discovered cancer in pancreas during a CT scan in 2003.Du...
Q: What do you think would happen if you tried to view a slide using the oil immersion lens but forgot ...
A: Q. What do you think would happen if you tried to view a slide using the oil immersion lens but forg...
Q: Name one environmental factor that typically influencesenzyme function
A: The rate of reaction of an enzyme was measured by the amount of substrate converted into a product. ...
Q: What will be the role of dentist in preventing antibacterial resistance
A: The ongoing in bacterial resistance is quite high hundreds of thousands of people become resistance ...
Q: What difference between RNA and DNA helps to explain the greater stability of DNA? What implications...
A: Deoxyribonucleic acid (DNA) is a molecule composed of two polynucleotide chains that twin around eac...
Q: Explain the relationship between turgor and osmotic pressure
A: Turgor pressure allows the osmotic entry of water through a semipermeable membrane into a cell. This...
Q: If the template DNA sequence is 3' - CCC - ATA - GAG - AAA - 5' , then what is the corresponding dau...
A: DNA is molecule which is present inside a cell and contain the genetic information of an individual ...
Q: What is the meaning of the word sterile? What would happen if culture media freshly prepared were no...
A: Sterile It refers to the state of being free from any bacteria or any other living microorganisms. S...
Q: which climate related factors shape biomes and how might they affect which organisms live in a parti...
A: ANSWER;- Climate includes temperature and precipitation, and it decides the developing season and so...
Q: A B Mega gametophyte H. M K F G E LL
A: Heterosporous vascular plants are consisted with the vascular tissues along with two types of spores...
Q: What is Cot analysis? Do the Cot renaturation curves for a virus, bacterium, and yeast all roughly c...
A: C0t analysis, which is based on the principles of DNA reassociation kinetics, is a biochemical techn...
Q: An Hfr strain of E. coli that is pro thr * leu * lac " was "mated" with an F- strain that is pro thr...
A: Introduction Genetic recombination is a process of exchange of genetic material between two differen...
Q: what is considered to be one of the most successful environmental agreement of all time and what is ...
A: According to many kinds of research and data's Montreal protocol is one of the most successful envir...
Q: What are the roles of ATP and NADPH in photosynthesis?
A: Photosynthesis is a process that plants and other living things use to convert light energy into che...
Q: Please discuss pathogenicity and the mechanisms by which microorganisms can attack the human body.
A: Any condition in which the body's normal structure or functioning is damaged or hindered is referred...
Q: DNA replication
A: Introduction:- DNA, also known as deoxyribonucleic acid, is a nucleic acid molecule. A 5-carbon deox...
Q: What is the most likely order of the linked genes R, S, and T if the distance between R and S is 22 ...
A: A linkage map, also known as a genetic chromosome map, is a linear graphic representation of the seq...
Q: What is true about the phosphorylation of ADP? O a) A phosphate group is added b) It is an exergonic...
A: ATP is the molecule that is responsible for releasing energy during hydrolysis. It provides necessar...
Q: Identify and explain the process by which cells expel materialsin bulkb
A: The movement of chemicals through the cell membrane is referred to as cell transport. The ability of...
Q: A 12-year-old boy is brought in by his mother with a 2-day history of fever and generalized weakness...
A: Peeiorbital erythema : skin redness Edema : swelling Opthalmoplegia : abnormal eye movement that o...
Q: Which of the following statement is not false? Cellulose containing foods can be consumed by humans ...
A: Human cannot digest cellulose. But we eat food rich in fiber that makes up plant cell walls. Nucleo...
Q: NERVOUS SYSTEM PATIENT TERMS ASSIGNMENT Identify the medical term for the following patient describe...
A: Nervous system disorder: Structural disorders in neurons present in brain , such as brain or spinal ...
Q: TRUE OR FALSE 1. A mutation is considered induced when a bacterial cell is exposed to harsh environ...
A: All the given statements are true.
Q: What is the underlying molecular mechanism of action for the antibiotic novobiocin?
A: Novibiocin is an antibiotic produced by the fungi belongs to actinomycete class which is Streptomyce...
Q: Which of the following is NOT TRUE about photosynthesis? O a) It takes multiple steps. O b) It.requi...
A: Photosynthesis is the light-driven synthesis of carbohydrates in plants. It takes place in specialis...
Q: What are the two main types of transport proteins? What are their functions?
A: The act or means by which a molecule or ion is transferred across the cell membrane or through the b...
Q: What is done when there is a delay of stool examination
A: Stool specimens can be examined fresh or preserved , if there's delay in Stool examination it should...
Q: Explain the relationship between the Vertebrata and these invertebrates.
A: Solution : Traditional metazoan phylogeny classifies the Vertebrata as a subphylum of the phylum Cho...
Q: Which of the following joins Okazaki fragments by forming the last phosphodiester/ester bond during ...
A: DNA Replication is a process in which two identical copies of DNA are made from the parent DNA mol...
Q: The Electron Transport System (ETS) The ETS must generate a hydrogen gradient (proton motive force) ...
A:
Q: please answer fast 4-year-old boy of a first-degree consanguineous couple was noted by the parents ...
A: The first-degree consanguineous couple is the relationship between two individuals that are closely ...
Q: What are the functions of the cardiovascular system?
A: The cardiovascular system consists of the heart, blood vessels, and blood. Its primary function is t...
Q: Which statement best describes the primary difference between bacteria and protists? In terms of cel...
A: Correct statement is In terms of cellular organization, bacteria are single-celled microbes and are...
Calvin cycle is a dark reaction.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- What is the molecule that leaves the Calvin cycle to be converted into glucose? a. ADP b. G3P c. RuBP d. 3-PGAThe Overall Free Energy Change for Photosynthetic NADP+ Reduction What is the overall free energy change (G) for noncyclic photosynthetic electron transport? 4 (700-nm photons) + 4 (680-nm photons) + 2 H2O + 2 NADP+O2 + 2 NADPH + 2H+Is the following statement true or false? Unlike animals, which make many ATP by aerobic respiration, plants make all of their ATP by photosynthesis.
- Which part of the Calvin cycle would be affected if a cell could not produce the enzyme RuBIsCO?Match each term with its most suitable description. ____ PGAL formation a. absorbs light ____CO2 fixation b. converts light to chemical energy ____ autotroph c. self-feeder ____ ATP forms NADPH does not d. electrons cycle back to photosystem ____ photorespiration e. problem in C3 plants ____ photosynthesis f. Calvin-Benson cycle product ____ pigment g. water molecules split ____ photolysis in photosynthesis h. rubisco functionWhat are the stages of the Calvin-Benson cycle? Select all that apply. The resulting unstable six-carbon molecule splits into two three-carbon molecules of PGA. ATP and NADPH are used to convert PGA molecules to PGAL. Most of the PGAL is used to regenerate RuBP, but some is exported to the cytoplasm to produce carbohydrates. Rubisco attaches CO2 to a five-carbon organic compound called RuBP. Rubisco is used to convert PGA molecules to PGAL.
- Which of the following are inputs of the Calvin Cycle? Choose all that apply. sunlight oxygen gas water G3P (precursor to glucose) carbon dioxide gas NADPH ADP+P NADP+ O ATPWhich of the following statements related to the Calvin Cycle is CORRECT? Six molecules of G3P are produced for every three carbon dioxide that undergo calvin cycle Carbon dioxide is attached to 3-phosphoglycerate resulting is 2 RuBP The regeneration of RuBP is important because it is directly used for the production of starch, cellulose, and glucose. One molecule of G3P exits the calvin cycle and five is used to form glucose for the production of starch, cellulose, and sucrose.Which of the following are products of the Calvin cycle that are then used as reactants in the light reactions? CO2 Sugar NADP+ O2 ATP NADPH ADP .
- What happens during the carbon fixation stage of the Calvin Cycle (light-indepedent reactions)? Energy from ATP and electrons from NADPH are used to reduce 3-phosphoglycerate to form G3P molecules (which can be used to form other organic molecules such as glucose) Oxygen is produced through this process The remaining G3P molecules that have exited the cycle are used to re-form RuBP through a series of chemical reactions, so that the Calvin cycle can continue. The enzyme Rubisco attaches to RuBP, causing the formation of molecules of 3-phosphoglycerateThe primary role of the Calvin cycle in photosynthesis is to: - split H2O and release oxygen - establish a proton gradient across the thylakoid membrane - use the energy in ATP and NADPH to fix carbon and build sugars - produce ATP and NADPH 2. The enzyme used to catalyze the initial fixation of CO2 in C3 photosynthesis is: Rubisco NADP+ reductase ATP synthase PEP carboxylase 3. The primary role of the light reactions in photosynthesis is to: - bring CO2 into the chloroplast use the energy in ATP and NADPH to fix carbon and build sugars establish a proton gradient across the thylakoid membrane produce ATP and NADPH *I do not need an explanation so please don't provide, I just need an answer choice picked for each*In the Calvin cycle, what is the name of the enzyme that attaches a molecule of carbon dioxide to the 5-carbon molecule called ribulose bisphosphate? Glyceraldehyde 3-phosphate Ribulose bisphosphate oxygenase Ribulose bisphosphate carboxylase, also known as RuBisCO 3-PGA carboxylase