Which heart do you think is most efficient at delivering oxygen rich blood to the tissues? O 3 chambered heart of amphibians O4 chambered heart seen in reptiles that are not birds O 2 chambered hearts of most fish 4 chambered heart seen in mammals and birds

Which heart do you think is most efficient at delivering oxygen rich blood to the tissues? O 3 chambered heart of amphibians O4 chambered heart seen in reptiles that are not birds O 2 chambered hearts of most fish 4 chambered heart seen in mammals and birds

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter36: Circulation

Section: Chapter Questions

Problem 1SQ

See similar textbooks

Related questions

Q: D. Fill in the table below. Determine the correct template and coding strands to properly answer…

Q: Will reveal RFLP polymorphism between the DNA samples after probe detection/visualization; and

A: Restriction Fragment Length Polymorphism (RFLP) is a difference in homologous DNA sequences that can…

Q: ? Which one is true For few seconds the blood supplies CO2 to cells and picks up 02. For few mints…

A: Blood Supply of Heart The heart receives its own supply of blood from the coronary arteries. Two…

Q: Is integrated pest management technique is better than using only one type of pest technique?…

A: IPM is the new method to prevent the pests from destroying our food that is growing anywhere in our…

Q: Supposing two strains of autotetraploid plants are available and their genotypes are as follows.…

A: Tetraploidy (four sets of chromosomes, 2n = 4x) is common in many plant species, and also occurs in…

Q: Test Ill- Encircle the word that should not belong to the group. 41. mushroom, yeast, bacteria, mold…

A: Spider is an arachnid, arachnids have eight legs.

Q: a. Use a labelled b. Explain how th operon?

Q: . In animals, cytokinesis occurs in which of the following phases of mitosis? a. Telophase b.…

A: Introduction: Cytokinesis is the literal division of a cell, which occurs in both mitosis and…

Q: A person has a blood pressure of 145/95. What does the number 145 represent? Select one: O a.…

A: ANSWER) (c) systolic pressure due to ventricles contracting. Systolic blood pressure is the pressure…

Q: Which of the following is least likely to produce genetic variation in the offspring of an…

A: Genetic variation is the changes in the genes of offspring from the parents. Meiotic cell division…

Q: eueu For each genotype below, select whether it is heterozygous, homozygous dominant, or homozygous…

A: First of all let us check what the terms mean, Heterozygous: It means an organism having two…

Q: 9. The water in warmer streams possess d. Feed the beans to the chickens, wait for the chickens to…

A: C. More ,less,more

Q: Select the correct statement about the function of myocardial cells. Cardiac muscle cells are…

A: Introduction The absolute refractory period of muscle cells refers to the time following a muscle…

Q: Gene flow can have one effect in the context of a single population, and a different effect in the…

A: Gene flow is the movement of genes or alleles between populations separated by geography. The…

Q: What is the average age in the United States that menarche typically begins? a. 10 c. 13 b. 12 d. 14

A: Menarche is one of the most significant periods in women's life. It is the beginning of menstrual…

Q: Discuss the importance of oxygen in this process of aerobic respiration.

A: Aerobic Respiration is the process of cellular respiration that occurs in the presence of oxygen gas…

Q: Why do dieters who follow Atkin’s diet (a diet high in fat and protein and very low in carbohydrate)…

A: Atkins diet It is diet that involves the uptake of foods that are rich in proteins and fats and the…

Q: Plants are highly dependent upon the resources of their enviroment. Explain how the lack of water…

A: In photosynthesis, two reaction has been shown light dependent reaction and light independent…

Q: Compare the reproductive organs of reptiles and birds. How are their reproductive patterns…

A: Introduction The biological system of an organism's reproductive system, often known as the genital…

Q: Elucidate the fundamental challenges the aquatic vertebrates and terrestrial vertebrates face in…

A: Terrestrial Vertebrates: Land-based (land-dwelling) Non-native Vertebrates (animals having a…

Q: S-TAGTAGGOOGCATOTTTTCCCATACAGATGAAGGATAAACTCGTCTXTAT-3 [x]-cleavage site for CFICFII endonuclease…

A: DNA ( Deoxyribonucleic acid ) is two stranded , ladder like helical structure that functions as…

Q: Please answer them correctly - Please answer all of them, they are connected. MUTATION Fill in the…

A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…

Q: How many steps (inhalations/exhalations) are needed to complete one ventilatory cycle in birds? 3…

A: Introduction Inspiration (or inhalation) and expiration (or exhalation) are the two phases of…

Q: Which is the smallest? O A. a human red blood cell O B. an E. coli cell O C. the influenza virus O…

A: The size of microbes is often defined as tiny. As a result, they are invisible to the naked sight.…

Q: Which of the following diseases is caused by a pathogen that is NOT a living organism? O A. Guinea…

A: A pathogen is an infectious agent that causes a disease. In general, there are five main types of…

Q: What are muscle groups that work together for a common action or movement called? O Antagonistic…

A: Anatomical terminology are terms used to determine the action , position , size of muscle.…

Q: Which of the following cells form new bone in bone tissue? osteons O osteoblasts osteocytes O…

A: The cells that forms new bone in bone tissue are osteoblasts. Explanation : Osteoblasts are the…

Q: You see that a piece of DNA is being copied. But you cannot tell if this an example of DNA…

A: DNA replication is a process that makes multiple copies of particular DNA fragments so that they can…

Q: 56 Platt and Glimcher found that the firing of neurons in the lateral intraparietal area are…

A: The lateral intraparietal area is located in the intraparietal sulcus of the brain and this region…

Q: Are Invasive Species All Bad?

A: Invasive species are the Exotic species which are introduced to a new habitat they have the ability…

Q: Which statement best describes a characteristic of ALL arteries? Select one: O a. Arteries lead…

A: Introduction Blood vessels are tubes that transport blood throughout the body. They form a…

Q: silence genes

A: Gene silencing is a mechanism that regulates gene expression to define cell fate and also regulates…

Q: This muscular blood vessel regulates blood pressure an blood flow to the capillaries. O Arteriole O…

A: Answer is arteriole

Q: Describe the underlying osmoregulation issues that aquatic and terrestrial animals confront, as well…

A: Osmoregulation is defined as the maintenance of water and salt concentration within the body.…

Q: A student was observing a filament of blue green bacteria under low power (60X). The diameter of the…

A: A. Average length of one cell = 2.4 mm/ 40=0.06 mm Under 60X = 40 cells, each is 0.06 mm in length

Q: Heparan sulfate proteoglycans appertain to which of the following processes?* a. transport by…

A: Heparan sulfate proteoglycans are the extracellular matrix proteins. These are basically the…

Q: different cues either The illustration above depicts a male redwing blackbird responding to two…

A: The male redwing blackbird is saving his territory from another male in order to attract female for…

Q: When the body is exposed to the same virus a second time, the immune response is Accompanied by…

A: Any foreign substances or pathogen can be harmful to an organism. Hence, the organism will develop…

Q: To explain: Why at anaerobic conditions the consumption of glucose by cells is high and at aerobic…

A: Metabolism refers to the collection of hundreds of enzyme-catalyzed reactions that the organism uses…

Q: The structure of the C4 leaf shows how mesophyll cells hug the epidermis of the leaf. hug the bundle…

A: Photorespiration is a wasteful pathway that occurs when the Calvin cycle enzyme rubisco acts on…

Q: You were asked to invent substitutes for blood vessels (artery, capillary, and vein). What materials…

A: To produce the vascular prostheses, polymer solutions were spun in an electrical field to form very…

Q: A measure of the productivity of photosynthesis is the rate of a. water production. b. heat…

A: d) Oxygen production .

Q: What do young herring gulls want when they peck the red spot on their parents' bills?

A: Pecking is a specialised behaviour in words suggesting that they need something. These birds are…

Q: In this example, we're going to see what happens when two traits are examined at the same time.…

A: Given information Fur and tail traits are observed at the same time. Dominant traits are black fur…

Q: Noncyclic photophosphorylation involves a constant source of new electrons. b. production of…

A: Photophosphorylation: It is conversion of ADP to ATP using the energy of sunlight by activation of…

Q: Remember for T/F questions, either answer TRUE or FALSE, but if the answer is FALSE make sure to…

A: Unlike bacterial RNA polymerase, the eukaryotic RNA polymerase cannot initiate transcription in…

Q: Which of the following is correct about feedback systems? O Positive feedback systems resist change…

A: Homeostasis refers to the process of maintaining internal physiological parameters in a changing…

Q: Which antibiotic would you want to take based on the results found in the table? I would take…

A: Zone Of Inhibition: A Zone of Inhibition Test, commonly known as a Kirby-Bauer Test, is a…

Q: Give two reasons why a point mutation in the codon for methionine (Met) would likely be more serious…

A: Point mutation is a mutation where a single nucleotide is changed i.e. insertion, deletion or…

Q: Transcribe and Translate the origininal DNA sequence, then in mutated dna sequence identify the Mrna…

A: Since you have asked the multipart question, we will solve the first three questions for you. If you…

Question

Which heart do you think is most efficient at delivering oxygen rich blood to the
tissues?
O 3 chambered heart of amphibians
O4 chambered heart seen in reptiles that are not birds
O 2 chambered hearts of most fish
d bird.
O4 chambered heart seen in mammals

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which circulatory system do you think is most efficient at delivering oxygen rich blood to the tissues of an animal? O Gastrovascular system seen in most Cnidarians O Closed circulatory system seen in vertebrates O Open circulatory system seen in many arthropods
Crocodilians, birds, and mammals heart has lungs receive охудen-роor blood one atrium and one ventricle Fishes heart has two atria and two ventricles Amphibians and most reptiles heart has two atria and one ventricle two-circuit one-circuit pathway pathway Reset
How is an insect's circulatory system different from a human's? O insects have closed circulatory systems, while humans have open O insects don't have a circulating fluid O insects lack a pump in their circulatory system O in insects the circulating fluid bathes the cells - it is also the interstitial fluid
Fish have a [ Select ] circulatory system in which blood travels from the [Select ] to the [ Select ] to become oxygenated, and then to the [ Select ] Thus fish do not have an extrav [Select ] body gills lungs single circuit double circuit like reptiles. pulmonary circuit Next « Pre heart pulmocutaneous circuit systemic circuit
At the venous end of a capillary: O a. The blood pressure equals the osmotic pressure. O b. All the plasma that was lost at the arteriole end is recovered back into the blood. Oc Glucose enters the blood. O d. Carbon dioxide enters the blood. O e. The blood pressure is higher than the osmotic pressure. Monotremes are very primitive mammals because:
Insects have a tracheal system that consists of: O a. Flat plates along the side of the body. O b. Amass of air filled tubes. O c. Blood vessels running just under the skin. O d. Apair of lungs extending inside the body. O e. Gills on the legs.
pestion Completion Status: QUESTION 8 The members of this order are often viviparous O A. Caudata O B. Gymnophore OC. Urodela D. Anura QUESTION 9 All of the following are true of the heart of amphibians except one, select the exception O A. It consists of a sinus venosus, two atria, a ventricle, and a conus arteriosus O B. The atria are completely separated from each other. O C. Blood entering the right side of the heart is often as well oxygenated as blood leaving the hea D. There is complete separation of oxygenated and less oxygenated blood throughout the heart QUESTION 10 The-- ------ directs blood away from the pulmonary circulation when a frog is burrowed into the A. Spiral valave Click Sare and Submit to save and submit. Click Save All Answers to szze all answers
Which of the following is the correct sequence of blood flow in mammals? 1 2 3 4 pulmonary artery ⠀⠀ right atrium vena cava right ventricle
How can you tell which side of the heart is the ventral surface (the surface closer to your chest)? How many chambers are found in the mammalian heart? List these chambers. Which chambers are the pumping chambers of the heart? Which chambers are the receiving chambers of the heart? How do the walls of the atria compare with the walls of the ventricles and why are they different? Which heart chamber has the thickest muscle wall? Why is it necessary for the chamber in the above question to have a thicker muscle wall? What is the purpose of heart valves? Name & compare the heart valves found between the upper & lower chambers of the right and left sides of the heart.
This circulatory system pattern is characteristic of: Fish ○ Birds ○ Crocodilians ○ All reptiles
Insects have a tracheal system that consists of: O a. Flat plates along the side of the body. O b. A mass of air filled tubes. Blood vessels running just under the skin. d. O d. Apairof lungs extending Inside the body. Gills on the legs.
rses/50898/quizzes/418452/take These These blood vessels are the [ Select ] arteries and the coronary [Select] capillary [ Select ] to pulmonary carotid cardiac 27 OTA stv MacBook Air 80