Which arrestin is required for activation of phosphorylation of MDM2 during chronic Iso stimulation? use the following Figures 1and 2 respectively to explain please
Q: Below are statements about symbiosis. Choose the correct responses. ( Only pick one answer per [ ]…
A: In nature animals, plants and microbes do not and cannot live in isolation but interact in various…
Q: Real estate developers want to build apartments outside of the city near an ancient forest. How…
A: Urban sprawl is the rapid expansion of the geographic extent of cities and towns, often…
Q: Using this image for reference, state whether the fitness for each trait combination is "low" or…
A: In terms of genetics, the fitness of an organism is the ability of an organism to survive in its…
Q: What is the logical explanation of the results shown in this study? O One hypothesis that could…
A: The researchers conducted a study to investigate the combined effects of trout and a parasite on…
Q: Assume that all carbon atoms and nitrogen atoms in both alanine and aspartate are labelled with…
A: In both alanine and aspartate, we must suppose that all of the carbon atoms and nitrogen atoms are…
Q: Imagine we census a population of rabbits (assume females only) that has been occupying a barn for a…
A: A census is an official count or survey of a population, typically recording various details of…
Q: Matching (Letters may be used twice) Where is the electron transport chain located? Where does the…
A: The statements mentioned discusses about the metabolic processes of glucose, such as glycolysis. In…
Q: What are characteristics to look for in an organism to evaluate it that organism has simple…
A: Simple multicellularity refers to a basic form of multicellularity where organisms are composed of…
Q: The loss of water from a plant by transpiration cools the leaf. Movement of water in transpiration…
A: In this answer, it aims to investigate the effect of substituting a nonpolar solution with similar…
Q: Describe some general insights that you can glean about population growth simply by looking at the…
A: Population dynamics is the variation of population over time. The population changes depends on the…
Q: Give typing answer with explanation and conclusion Which of these is not one of the benefits of…
A: Sustainable soil, ecology, and human health are all benefits of organic agriculture. Instead of…
Q: Please match each word on the right to the correct box(es): Bloomington, Sisyphus, Mantis, Bees,…
A: A complex network of living things, such as plants, animals, and microorganisms, interacting with…
Q: numbers may only be used twice. I see 8 3 times
A: Metabolic process are the chemical…
Q: 1. The diagram shows the blood vessels associated with alveoli. B branch of the pulmonary artery.…
A: To obtain oxygen into the blood, the circulatory system (cardiovascular system) pushes blood from…
Q: construct an ultrametric phylogenetic tree.
A: In bioinformatics, an ultrametric phylogenetic tree represents the evolutionary relationships…
Q: the highlighted structure is the ??
A: The adrenal gland is a small, triangular-shaped endocrine gland located on top of the kidneys,…
Q: How do I write a thesis?
A: Thesis writing might be a difficult and complex process, but with a methodical approach, you can…
Q: You inoculated a culture with an initial cell count of 6.5x10^3 cells. The generation time for this…
A: Bacteria are prokaryotic organism and divides by binary fission that is responsible for doubling the…
Q: What is a proper description of the shape of the bacteria in the picture? Bacilli Cocci Vibrio…
A: Microorganisms known as bacteria come in a variety of sizes and configurations and shapes. Bacilli…
Q: Choose all of the following true statements. Hint: 6 statements are true. □ If an electron moves…
A: We will analyze each statement with proper justification and decide if it is true or false.
Q: Vascular endothelial growth factor receptor 2 (VEGFR-2) is an endothelial cell-specific receptor…
A: Angiogenesis, the process of forming new blood vessels from existing ones, plays a crucial role in…
Q: design a synthetic nucleotide that can be integrated into a DNA molecule AND be functional.
A: We discuss the thought of making a synthetic nucleotide that can be consolidated into a DNA molecule…
Q: Which of the following are true about human variation? (Choose all that apply): Group of answer…
A: The variety of genetic and phenotypic variations seen among members of a population are referred to…
Q: If Individual 4, Generation IV, Family B were to mate with a recessive male, what would be the…
A: Gene is the structural and functional unit of heredity. A gene exists as two alternative forms…
Q: A culture of E. coli is diluted as follows: (1) 65mL are added to 435mL of water. (2) 10uL from (1)…
A: DilutionIt refers to the process of reducing the concentration of a substance in a solution by…
Q: What contributions have laboratory and mathematical models made to our understanding of…
A: An ecosystem is composed of different biological organisms living in the same area. A predator is an…
Q: A cesarean section that involves an incision in the upper segment of the uterus is coded as
A: Occasionally, a transverse incision in the upper segment of the uterus is used to perform acaesarean…
Q: What are your thoughts on vaccination and their usefulness
A: Vaccination is the process of administering vaccines to individuals to stimulate their immune system…
Q: How respiratory and cardiovascular systems work together to maintain homeostasis of the blood ?
A: The circulatory and respiratory systems are crucial parts of the human body that cooperate to keep…
Q: Figure 10-13 Malecular Biology of the Ceil de (Garland Science 2015) fluorescence in bleached area-…
A: Fluorescence Recovery After Photobleaching (FRAP): -A specific area of a fluorescently labelled…
Q: Importance of food inspection in relationship to public health act
A: Globally, foodborne illness poses a serious public health concern.Due to the differing efficacy of…
Q: A controlled experiment ________. A. includes one group for which the scientist controls all…
A: In the realm of scientific inquiry, controlled experiments play a crucial role in testing hypotheses…
Q: List two disorders caused by lifestyle choices fro each system: a.) digestive b.) respiratory c.)…
A: "Lifestyle choices can significantly impact our health, leading to the development of various…
Q: A student is writing a draft of a scientific report on the effect of prolonged hot temperature on…
A: Title: Understanding Scientific Report Writing: Structure, Purpose, and Key…
Q: why would selecting a colony from a blood agar plate to test with enterotube be bad
A: Selecting a colony from a blood agar plate to test with an Enterotube may not be ideal for several…
Q: How histology of compact hard bone shows adaptations of storage for calcium and skeleton support
A: Compact hard bone, also known as cortical bone, forms the outer layer of bones in the skeletal…
Q: The discovery and mass-production of antibiotics has triggered a revolution in medicine, decreasing…
A: The discovery and widespread use of antibiotics have revolutionized the field of medicine, enabling…
Q: Work N2. Initial isolation of pure culture anaerobic microorganisms from mixture of bacteria soil…
A: When separating anaerobic microorganisms from a mixture of microbes, it is essential to utilize…
Q: At what stages in the development of a human has the evolutionary process introduced genetic…
A: The evolutionary process introduces genetic diversity at several stages during the development of a…
Q: What factors might eventually limit the exponential growth rates of a particular insect species…
A: Growth can be defined as irreversible increase in the biomass of the organism or it can be defined…
Q: Based on the picture write description changes in the morphology of the cultures and the presence of…
A: Plant tissue culture (PTC) refers to in vitro culturing of plant seeds, explants, plant organs,…
Q: In the RNAi response: Group of answer choices Dicer produces siRNA from the trigger molecule. These…
A: Gene regulation is greatly aided by RNA interference (RNAi), which is a vital biological function.…
Q: Relate histopath criteria of cancer to H nana cell cycle & chromosomal instability. Analyze the…
A: The question investigates a potential connection between chromosomal instability, H. nana's cell…
Q: 16) If individuals III-2 and III-3 have an additional child, what are the chances that it'll be an…
A: Pedigree analysis helps us understanding the mode of inheritance of a particular disease by…
Q: Write a lab report on enumeration of lytic viruses : the plaque assay including the sections:…
A: Lytic viruses are a class of viruses that infect and replicate within host cells, eventually causing…
Q: Compare and contrast the results from bootstrapping analysis on the maximum likelihood phylogeny…
A: When the results of bootstrapping investigation on maximum likelihood phylogeny and Bayesian…
Q: what is k and r for each condition? K (carrying capacity): can be estimated by finding the point…
A: The presence of limited energy in the organisms for spending on basic metabolic needs, reproduction,…
Q: Vascular endothelial growth factor receptor 2 (VEGFR-2) is an endothelial cell-specific receptor…
A: Angiogenesis, the formation of new blood vessels from pre-existing ones, plays a critical role in…
Q: 1. You are studying a variant in a gene controlling wing development, Wng, in Drosophila. Using…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Create an A3 poster that demonstrates the following genetic concepts: The difference between…
A: Different types of variation seen in traits or features within a population are called continuous…
Which arrestin is required for activation of phosphorylation of MDM2 during chronic Iso stimulation?
use the following Figures 1and 2 respectively to explain please
Step by step
Solved in 3 steps with 1 images
- One of the causes of morbidity for the Zika Virus is Guillain-Barré Syndrome, an immune attack of nerve cells. One possible mechanism for this is the virus's interference with normal immune function. In HIV the virus uses the CD4 receptor to enter T-cells. To assess if this might be a possibility in Zika infections BLAST the CD4 Reference Sequence (NG 027688.1) against the Zika Virus (taxid:64320) choosing "blastn" under Program Selection (select all that apply): O None of the recovered sequences have identities of greater than 80%. O Multiple Zika virus isolates are observed to have E-values of less than 0.02. O High scoring BLAST hits are observed in Zika virus isolates from humans, mosquitoes, and monkeys. O The BLAST hits return a partial cds collected in Uganda in 1947 - isolate Uganda1947.4:17 Regarding chronic disease prevention, match each term with the phrase that best describes it Molecule produced by innate immune cells. that is involved in maintaining chronic inflammation A protein produced by the liver that is al frequently used marker of chronic inflammation The degree to which a certain food elevates blood glucose after it's eaten A small molecule that can bind to histones and DNA, frequently with the result of gene silencing An enzyme that rebuilds the end caps of chromosomes after each cell division, thus prolonging the life of the cell [Choose] [Choose] Interleukin-6 TNF-alpha Methyl Tag Glycemic Load C Reactive Protein Glycemic Index Telomerase [Choose] [Choose ] [Choose] X11.5 A A Aa-AE-E-¹5- U - abe X₂ X² A-ay-A- Font Ulla Unigriffin DNA: mRNA: amino acids: traits: DNA: traits: mRNA: amino acids: · DNA: mRNA: to search #N O E Et CE- Paragraph $ 15 Ser 1. CAT AGG GAG | CAA GGG TGA CTT TTT | AAT AAT GAC GGG | A E ALT | CAA TTG TTA CGG | AAA AGA CCC | GCC ATA ACA TTT | % STP | CAC CGT CGA | GTA GTA | AGA GGG CAT | TTG TAA GGA GGG GGG TGT | 16 AaBbCcDc AaBbCcl AaBbCcL Aa BbCcDc 1 Normal 1 Body Text 1 List Para... 1 No Spac... W] Tyr 17 Val & 7 Gly E CO OM no num lk T Aa Bb Cc 1 Table Pa (p)) Styles 12 P
- 11 111 FLATRON WIS songs to listen to on a late n (1) Messenger f 253282375 390061782796379 8 x ++ Scontent.fmnl17-4.fna.fbcdn.net/v/t1.15752-9/253282375 390061782796379 8678836692018933574_n.jpg?_nc_cat3D105&ccb%3D1-5&_nc_sid=Dae9488&_nc_eui2=DAeERUdQ E Apps Discussion Questions (answer these questions on a separate sheet of paper) 1. Explain how hCG secretion is regulated. Is it secreted by a pregnant woman or her offspring? 2. hCG depresses some reactions of the immune system. What adaptive advantage do you think this has? Ac P Type here to search LGBM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation LeadpleMM, a 54-year old female presents to the Family Medicine Clinic due to a 2-week history of increasing shortness of breath and cough and mild/moderate pain in left side. She was diagnosed with infiltrating intraductal adenocarcinoma of the left breast 5 years ago; at that time, ER(-)/ PR(-); her-2/neu(+); p53(+); staged as having T3N1M0, stage IIIA, high-risk breast cancer. She underwent a modified radical mastectomy with axillary node dissection followed by 6 cycles of CMF chemotherapy. Her mother and sister also had a history of breast cancer. Past Medical History Gravida 4, para 4; menses onset age 13; HTN x 10 years; Type 2 DM x 8 years; breast CA described above; remained disease free until present follow up. Past Surgical History: Left modified radical mastectomy 5 years ago; cholecystectomy 14 years ago. Medications: Glyburide, 5mg PO BID Verapamil SR, 240mg PO daily Furosemide, 40mg PO daily Allergies: NKDA Physical Examination: GEN: Well-developed, obese woman in no…
- For the following diseases, describe the best technique for diagnosing them. Please make sure you include how you would tell someone with the disease from someone without the disease. B. Factor V Leiden thrombophilia is caused by a point mutation at position 1691 in exon 10 of the Factor V clotting factor gene that changes an arginine into a glutamine. This change removes one of the cleavage sites for activated protein C and leads to an increased tendency to clot.THE MOLECULAR GENETICS OF SICKLE CELL ANEMIA The following is the base sequence of DNA that codes for first eight amino acids of the ß chain of hemoglobin. The ß chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. mone formed DNA Template Strand: 3'CACGTGGACTGAGGACTCCTC5' 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 4. What amino acids will this mRNA code for? 3. What mRNA will be formed from the template strand of DNA? 5. If the 17th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is this? 67THE MOLECULAR GENETICS OF CYSTIC FIBROSIS and of The following is the base sequence of DNA that codes for amino acids 506-510 of the protein that regulates the chlorine channels in the cell membrane. This protein contains a total of 1476 amino acids so this is a small part of the entire gene. DNA Template Strand: 3'TAGTAGAAACCACAA5' 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA? 4. What amino acids will this mRNA code for? 5. If the 6th, 7th and 8th bases in the template strand of the DNA are removed, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is this? 65
- 1_30*_SP23 - General Biology I (for majors)/1 of us page The anticodon sequence created from the following DNA: TACGGGGCTGAGATT F1 Select one: O a. Tyr-Gly-Ala-Glu-lle O b. AUGCCCCGACUCUAA c. UACGGGGCUGAGAUU O d. Met-Pro-Arg-Leu-STOP F2 # 80 F3 $ 000 000 F4 % F5 MacBook Air F6 & r F7 DII F8Tenofovir, an analog of adenosine monophosphate, is a nucleoside reverse transcriptase inhibitor used to treat HIV infection. Atazanavir, also used to treat HIV infection, is a protease inhibitor. Approximately 1 in 1,000 virus particles carries a mutation that confers resistance against any given anti-HIV drug. If there are 1010 virus particles circulating in a patient, roughly how many of them would be resistant to both tenofovir and atazanavir? - 104 - 106 - 107 - 5 x 107 - 1010The haemoglobin proteins of RNA polymerase ii sub units RPB1-P24928 RPB2-P30876 RPB3-P19387 RPB4-015514 are they similar? Explain?