Q: To ensure easier focusing, what should be done first before the HPO is swung into position?
A: High power objective lens is used to examine fine details of the given specimen. The total magnifica...
Q: The achoo syndrome (sneezing in response to bright light) and trembling chin (triggered by anxiety) ...
A: Since human cells Carry 2 sets of chromosomes having same set of genes. So these 2 version of genes...
Q: Edmontosaur or hardosaurs what ways can they defend itself from predators like large with powerful j...
A: INTRODUCTION Endmontosaurs They are large dinosaurs lived in North America during late Cretaceous pe...
Q: Mitosis and cytoplasmic division function in .a. asexual reproduction of single-celled prokaryotesb....
A: Mitosis and cytoplasmic division are described as a process where the cell of an organism is divided...
Q: Most healthy body cells spend the majority of their lives in_____ . a. prophase d. telophase b. meta...
A: Introduction All living organisms are made up of cells, which are the basic building components. The...
Q: Figure It Out #5...Name that Complex Carb Fiber Sucrose Starch and Fiber Human Brain Human Liver Coo...
A: Galactose: Human Brain Fiber and Starch: Whole wheat bread Fiber and Sucrose: Starburst, Strawberry ...
Q: Draw the molecular structures of the products obtained when 1-palmitoyl-2-oleoyl-3-phosphatidylserin...
A: Phospholipases are the enzymes which serves for different functions. Phospholipase A1 enzyme hydroly...
Q: The role of creatine phosphate in muscle cells is to: provide energy for muscles during extended phy...
A: Creatine phosphate serves as an “energy buffer” in muscle it is a high-energy, phosphorylated, nitro...
Q: Biochemical Molecular analysis of the bela glo Saudi sickle 3. Describe the effect of thelamino acid...
A: Introduction :- Amino acids are the building blocks of any polypeptide or protein structure . The se...
Q: 1. Centrioles are only found in cells. They function in cell They have protein fibers. Draw a pictur...
A: *NOTE: Kindly repost for other questions. Dear Student as per the guidelines we are supposed to answ...
Q: for the virulence of a phage. A bacteriophage solution of a given concentration is inoculated with t...
A: Virulence of a phage: it is the ability of a virus to infect and cause their effect to the host orga...
Q: Describe the scope of human population growth
A: Population growth is the increased number of humans in the world. Most of the human history shows th...
Q: How can people effectively manage stress when diagnosed with cardiovascular conditions?
A: When people diagnosed cardiovascular conditions than how can manage stress
Q: What are the typical reactions observed when incubating lactic acid bacteria in litmus milk?
A: Because it includes the milk protein casein, the sugar lactose, vitamins, minerals, and water, milk ...
Q: Explain how temporal and spatial variation can change outcome of competition (which means you need t...
A: Spatial variation: Some specific places are benificial to the organisms to survive, so if the variat...
Q: The world has been greatly affected by the pandemic caused by COVID-19. Countries all over the world...
A: The pandemic caused by the novel Corona virus has devastatingly affected the countries around the wo...
Q: Which of the following groups include at least some members that exhibit internal fertilization? Cho...
A: Internal fertilization is the process of fertilization that occurs inside the body of an individual....
Q: 2. How should the following patients be identified? a. siblings or twins b. newborns C. common names...
A: Identification is essential in both civil and criminal cases in living persons (cases like divorce, ...
Q: Which of the following characteristics are present in Vertebrates? Choose all that apply. O triplobl...
A: 1) Triploblastic : Triploblastic animals are those in which the the blastoderm layer divides in thre...
Q: There are two broad classes of transposons. Each class is characterized by its method of "jumping" (...
A:
Q: What are the enzymes and proteins involved in DNA replication?
A: DNA replication is a process that uses enzymes and proteins to create two identical DNA molecules fr...
Q: Which is a characteristic of pseudoscience or bad science? a) Considers evidence for and against a h...
A: Pseudoscience comprises explanations, beliefs, or practices that case to be both logical and authent...
Q: If you want to do one thing to control stress, keep good bone density into late adulthood, keep your...
A: *The stress and bone density and weight and cardiovascular running should have to keep healthy to re...
Q: What are the current trends and innovations in International Blood Bank Laboratories?
A: Recent innovations in the field of Blood Bank Laboratories are:- Blood Bank Information System: - C...
Q: Are you a hidden heterozygote? A PCR analysis (part2) Agarose gel electrophoresis and interpretation...
A: Agarose gel concentration More the concentration of the agarose gel more smaller will be its pores....
Q: Which of the following are jawless? Choose all that apply. O hagfish O lampreys O bony fishes O cart...
A: Jawless organisms are belongs usually to class Agnatha and primitive in nature.
Q: In your own words, Explain how can the Subject Personal Identification of Fingerprinting benefiting ...
A: Introduction: The technique which is used to identify and analyze the variation on the basis of vari...
Q: B Red line F G E D Cornea [ Choose ]
A: The human eye is one of the sense organs that can detect vision by responding to light. The rods and...
Q: What is the importance of Recombinant DNA Technology in the Molecular Laboratory
A: Recombinant DNA technology- Recombinant DNA technology is the joining of two different DNA molecules...
Q: Andalusian chickens may be either black, white, or gray. The gene for black is not dominant over th...
A: Note- we are supposed to answer 1 question with three subparts according to our guidelines. Please r...
Q: II. Give the translation of the segment of a polypeptide chain below. Specify your template strand. ...
A: Translation is process in which proteins are synthesized.
Q: Describe the impact that the need for lumber and agricultural land has had on the environment. Expla...
A: Impact of Lumber on the environment:- Increases the harmful effect of winds and rain The local val...
Q: Does the mechanism of recombination of unlinked genes require crossing-over? Explain your answer.
A: No, the mechanism of recombination of unlinked genes does not require crossing-over.
Q: 7. A researcher examining a root tip observes a plant cell with condensed sister chromatids, kinetoc...
A: Mitosis is the equational division where two genetically identical daughter cells are formed. In the...
Q: Discuss the 4 lobes of the brain its function and relation to our behavior
A: Our brain is divided into 4 different areas that execute particular functions, these are known as lo...
Q: what are the important words in the study of Nutrition
A: Nutrition It is the process by which body utilizes food for growth and maintenance and healthy livi...
Q: Proteins can be separated into 9 general classifications based on the role they play in a cell. List...
A: Proteins can be classified into following types:- Fibrous Proteins Globular Proteins Derived Protei...
Q: Remember that although there are many interesting ideas about genetic engineering of plants and anim...
A: Transgenic bacteria are bacteria whose genome contains genes from other organisms that have been del...
Q: Use an example to describe tumor suppressors
A: Cancer is the state of uncontrolled cell division that has some genetic factors.
Q: Describe the purpose of cell cycle checkpoints.
A: Introduction The cell cycle is controlled by various internal and external factors such as the amou...
Q: Show how data from a two-point test cross can be used to distinguish between independent assortment ...
A: Linkage is the tendency for a pair of genes on the same chromosome to be transmitted down to subsequ...
Q: Our DNA sequence: 5' - CGCTTATAATCGTTACGACGGCAATTA CGGGATTCCTCGCGAAA - 3'. What is the RNA transcrip...
A: The nucleic acids are DNA and RNA. Nucleotides, which have a five-carbon sugar backbone, a phosphate...
Q: Nucleotides - U - T -Sugar & Phosphate - Anticodon - Codon - Ribose - Transcription - Transl...
A: The central dogma consists of DNA to DNA (Replication) DNA to RNA (Transcription) RNA to proteins (...
Q: You are Jeremy’s Biology professor, and he ask you about taking steps to “bulk up”. What would your ...
A: Being a doctor and taking this question as in general category. One should do the followings things ...
Q: Which of the following are true about the logic we use to identify alleles under positive selection ...
A: 1)Alleles under positive selection occur at relatively high frequency. Positive frequency dependent ...
Q: What effect do sodium, caffeine, and alcohol have on calcium levels in the body?
A: The human body is made up of everything that makes you, you. Our genetic information determines and ...
Q: MATCH EACH WITH THE LETTER. 1. RIBOSOME 2. NUCLEUS 3. ROUGH ENDOPLASMIC RECTICULUM (ER) 4. SMOOT...
A: Matching of cell organelles with their functions :-
Q: Name and describe the idea that explains how mitochondria and chloroplasts are thought to have origi...
A: Photosynthesis is the process through which green plants and some organisms use sunshine to convert ...
Q: Determine which of the following passages are arguments. For those that are, identify the conclusio...
A: Note- As we are allowed to answer only one question at a time. I will provide answer for only first ...
Q: Hardosaurs like edmontosaur the front feet do they have name or description how they look? It looks ...
A: The comb-crested hadrosaurid (duck-billed) dinosaur Edmontosaurus regalis is a species of comb-crest...
What is the relationship of evolution and human behavior?
Step by step
Solved in 2 steps
- How can behaviors be adaptive? Provide an example that includes support from the five tenants of evolution by natural selection: 1) overproduction of offspring, 2) variation in the population, 3) competition for resources, 4) adaptive advantage for some, and 5) reproduction for those who surviveIf heredity is the passing on of traits from parents to their offspring, how is evolution possible?What will be the importance of evolution to all living things?