QUESTION 4What is the mechanism by which microtubules can rapidly shrink, or undergo "catastrophe"? AAt low levels of GTP, tau proteins are phosphorylated and bind to the microtubule to destabilize the + end. BAt low levels of GTP, beta-tubulin subunits at the + end of the microtubule hydrolyze GTP, undergo a conformational change, and destabilize the filament so that the filament starts to disassemble from the + end. CAt low levels of ATP, tubulin subunits are not added to the + end of the microtubule. DAt low levels of ATP, the microtubules rapidly disassemble since ADP-bound tubulin subunits are lost at both the + and - ends of the filament. EAt high levels of GTP, tubulin subunits are more quickly added to the - end than to the + end of the microtubule, resulting in the shrinking of the + end of the microtubule.

Microtubules, along with microfilaments and intermediate fibers, structure the cell cytoskeleton.…

What is the mechanism by which microtubules can rapidly shrink, or undergo "catastrophe"? A At low levels of GTP, tau proteins are phosphorylated and bind to the microtubule to destabilize the + end. B At low levels of GTP, beta-tubulin subunits at the + end of the microtubule hydrolyze GTP, undergo a conformational change, and destabilize the filament so that the filament starts to disassemble

What is the mechanism by which microtubules can rapidly shrink, or undergo "catastrophe"? A At low levels of GTP, tau proteins are phosphorylated and bind to the microtubule to destabilize the + end. B At low levels of GTP, beta-tubulin subunits at the + end of the microtubule hydrolyze GTP, undergo a conformational change, and destabilize the filament so that the filament starts to disassemble

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter4: Cell Structure

Section: Chapter Questions

Problem 23RQ: The key components of desmosomes are cadherins and. actin microfilaments intermediate filaments...

See similar textbooks

QUESTION 4

What is the mechanism by which microtubules can rapidly shrink, or undergo "catastrophe"?

	A	At low levels of GTP, tau proteins are phosphorylated and bind to the microtubule to destabilize the + end.
	B	At low levels of GTP, beta-tubulin subunits at the + end of the microtubule hydrolyze GTP, undergo a conformational change, and destabilize the filament so that the filament starts to disassemble from the + end.
	C	At low levels of ATP, tubulin subunits are not added to the + end of the microtubule.
	D	At low levels of ATP, the microtubules rapidly disassemble since ADP-bound tubulin subunits are lost at both the + and - ends of the filament.
	E	At high levels of GTP, tubulin subunits are more quickly added to the - end than to the + end of the microtubule, resulting in the shrinking of the + end of the microtubule.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

QUESTION 13 What is the mechanism by which microtubules can rapidly shrink, or undergo â catastrophe?â A At low levels of ATP, tubulin subunits are not added to the + end of the microtubule. B At low levels of GTP, beta-tubulin subunits at the + end of the microtubule hydrolyze GTP, undergo a conformational change, and destabilize the filament so that the filament starts to disassemble from the + end. C At low levels of GTP, tau proteins are phosphorylated and bind to the microtubule to destabilize the + end. D At high levels of GTP, tubulin subunits are more quickly added to the â end than to the + end of the microtubule, resulting in a shrinking + end of the microtubule. E At low levels of ATP, the microtubules rapidly disassemble since ADP-bound tubulin subunits are lost at both the + and â ends of the filament.
Question 5 What is the role of TRF2 at the telomere? extends the 3' end of the G+T strand O packages DNA into heterchromatin O forms a platform for microtubule attachment O facilitates formation of the t-loop at the telomere and recruits RAP1
Descrive in 2-3 sentences an in vitro experiment that differentiates between the Arp2/3 complex’ ability to associate with both the side of the ‘mother’ actin filament and with the barbed end of the ‘mother’ actin filament. Your experiment should take advantage of capping protein (binds and blocks barbed ends), and direct visualization of actin filaments.
QUESTION 2: Select the correct statement regarding the actin cytoskeleton O They are involved in the formation of the axoneme Actin microfilaments are the most stable rytoskeleton network can undergo catastrophe due to GTP hydrolysis-mediated conformational changes Synthesis and degradation of actin microfiaments is directional with g-actin subunits added only to the end of the microflament while depolymerization occurs at the end. QUESTION 3: From the list below salect the correct statements regarding the genetic code The basis of the genetic code are codons Cosons are formed by 5 consecutive nucleotides The genetic code has a possibile 64 different codem Codos code for 30 distinct amo acas The genetic code has built in degeneracy
The key components of desmosomes are cadherins and. actin microfilaments intermediate filaments microtubules
Dynamic instability causes microtubules either to grow or to shrink rapidly. Consider an individual microtubule that is in its shrinking phase. What would need to happen at the end of the microtubule in order for it to stop shrinking and to start growing again? Be specific! What would happen if only GDP, but no GTP, were present in the solution? What would happen if the solution contained an analog of GTP that cannot be hydrolyzed?
Question 7. What is the rate-limiting step in the formation of an actin microfilament?
"In most animal cells, minus end-directed microtubule motors deliver their cargo to the periphery of the cell, whereas plus end-directed microtubule motors deliver their cargo to the interior of the cell", is true or false.
QUESTION 30 If a cell could not make histones, what would happen? O Its DNA would not be packaged properly O Its DNA would get shorter O It could not transport DNA outside of the nucleus Transcription would not be able to take place.
Question 2. In the presence of low levels of GTP, microtubules inside a cell will undergo due to
Microtubules in an animal cell: O a. undergo assembly if the concentration of GTP-bound tubulin dimers is high and a cell is exposed to vinblastine O b. undergo disassembly if the concentration of GDP-bound tubulin dimers is high and a cell is exposed to taxol O c. undergo disassembly if the concentration of GTP-bound tubulin dimers is high and a cell is exposed to colchicine O d. undergo assembly if the concentration of GTP-bound tubulin dimers is high and a cell is exposed to colchicine
Question one parts A though E a. True / False: Guanine to cytosine intermolecular interactions (hydrogen bonding) is stronger than adenine to thymine. b. What peptide would be made from the following DNA sequence? 5'ATCCCGGGTACTCACTCCCAT3' Start-Gly-Pro-Stop Start-Gly-Ser-Pro-Val-Arg-Val Start-Gly-Gly-Thr-lle-Arg Start-Arg-Arg-Gly-Gly c. Starting from the MRNA strand below - what peptide would be produced? Remember your start and stop codons...5'CCAUGCGGCAUACCAAAUUACUAAACUAGC3' Start-Arg-His-Thr-Lys-Leu-Leu-Asn-Stop Start-Asn-Leu-Leu-Lys-Thr-His-Arg-Stop Start-Arg-Lys-Leu-Asn-Stop Pro-Met-Arg-His-Leu-Leu-Asn d. Which type of RNA comprises over 80% of total cellular RNA? ribosomal RNA Messenger RNA Transfer RNA e. True / False - All of the DNA nucleotides are attached to the deoxyribose in the BETA configuration (at the anomeric carbon of the sugar). B (Ctrl) -