Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and ends with a stop codon, so it is only looking at the region of DNA that directly encodes a protein sequence. 5’-AUGCACAAAUUAGAGUACCCCCCAGGAAGGUAG-3’ Make the following mutation in this sequence by changing/adding/removing only one nucleotide. Make the mutation easy to see (a different color, circled, something like that) A frameshift mutation
Q: 4. Martha Peterson is a 16-year-old child who presents to the endocrine clinic. Martha has not had…
A: “Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: "Continual addition and removal of phosphates by protein kinase and protein phosphatases is wasteful…
A: It is well known that protein kinase changes a molecule's phosphate group. The phosphate group is…
Q: A somatic cell is a cell specialized for maintenance an growth in an organism. Group of answer…
A: INTRODUCTION Somatic cell Any cell in the body other than germ cells and stem cell.
Q: You are designing an experiment where you are doing a point mutation changing an aspartate residue…
A: Merrifield synthesis, it work with solid phase peptide . it help in research of chemistry and…
Q: blunt trauma
A: Blunt trauma: It is an injury to the abdomen. It includes the following signs and symptoms -…
Q: Explain what would happen to a substrate molecule if it encountered an enzyme’s active site that…
A: Enzymes are biocatalyst that perform specific chemical reactions in the living organisms. They are…
Q: Without enzymes , reactants would never from products False or true ?
A: Introduction Protein catalysts called enzymes are essential for numerous bodily activities. Enzymes…
Q: im confused, what is the answer?
A: The root system and the shoot system are the two main structures in plants. Every one of these…
Q: MADs-box genes are homeotic genes affecting plant development. Group of answer choices True False
A: The MADs box proteins present in different organisms play an vital role in maintaining growth,…
Q: One of the following plant organs does not have any modification for any purpose. a. Leaf b. Stem…
A: Introduction Modifications means refinement or reconstruction. When plant undergo certain…
Q: Discuss and explain how a child inherits one copy of each gene from each parent. What processes…
A: Introduction Due to the process of sexual reproduction, children inherit one copy of a gene from…
Q: Whether the statement "When bidirectional replication forks from adjacent origins meet, a leading…
A: Introduction :- A single DNA strand known as the leading strand is reproduced in the 3' to 5'…
Q: How does exercise affect the heart?
A: The heart is an essential part of our body that helps to pump blood and oxygen into the body. There…
Q: What neurotransmitters are mimic when cocaine or other stimulants are consumed in your body?
A: Introduction :- Your body cannot function without chemical messengers called neurotransmitters.…
Q: How molecular chaperones manage themselves to assist in correct protein folding.
A: The broad group of unrelated protein families known as molecular chaperones includes the hsp25,…
Q: Which statement about the cellular arrangments of bacteria is NOT correct? Spiral bacteria are…
A: Bacteria are simple, Prokaryotic organisms which donot have membrane bound nucleus,or membrane bound…
Q: 1. Researchers at the University of Adelaide, Australia, are proposing to control cyanobacteria with…
A: A microorganism is an organism which cannot be seen with the naked eyes, they can be seen using a…
Q: I need help with a biology question The presence of chiasmata indicates that two non-sister…
A: What is chiasmata? During meiosis, when non-sister chromatids of homologous chromosomes exchange…
Q: Other than larger brain / greater intelligence, which single behavioral or biological innovation /…
A: Evolution is a naturally continuously occurring process that occurs in almost all biological…
Q: answer the given question below. multiple answer is possible and if non of the answer is you think…
A: The cells created during cleavage start to move in relation to one another during gastrulation. As…
Q: The direction of movement of RNA polymerase along the template to generate supercoiled structures in…
A: Introduction:During the expression of genes, the RNA polymerase enzyme converts DNA to RNA. The DNA…
Q: Q1: In your own words, describe the 'Food Guide snapshot' in the new Canada Food Guide (i.e., the…
A: Introduction Healthy diet refers to the diet plan which helps to improve or maintain our health…
Q: "once cells have differentiated to their final specialized forms, they never again alter expression…
A: As an individual develops, cell differentiation progresses from the zygote's basic structure to a…
Q: Examine whether the statement "Gene duplication and divergence is thought to have played a critical…
A: Gene duplication is caused by the duplication or amplification of a gene sequence. DNA damage,…
Q: Butterfly A mates with Butterfly B. What are the genotypes of the two P generation butterflies if…
A: Introduction The term "genotype" refers to an organism's whole gene pool, or, in other words, the…
Q: Experiment: Lipids Qualitative Tests Test Performed: Translucent Test Procedure for Translucent…
A: Fats and lipids are important biomolecules. These are molecules with a more energy as compared…
Q: A teaspoon of sugar supplies about 16 kcals, which is the same as ________ calories. 16,000…
A: Introduction: A calorie is an amount of energy that is equal to the energy necessary to increase the…
Q: MODIFIED TRUE OR FALSE. In the following items, read each statement carefully. I. About 20 L of…
A: Innate immunity is the body's defence mechanism that is present at birth. Adaptive immunity is the…
Q: 11. What is the probable mode of inheritance for the trait in the pedigree below Examine the…
A: The pedigree is a kind of family tree which depicts a mode of inheritance of a particular trait.
Q: examine whether the statement "since introns are largely genetic 'junk; they do not have to be…
A: Following transcription, both coding and non-coding intron and exon sequences are combined to form…
Q: I need help with a biology question: If gametes have 10 chromosomes, the cell resulting from…
A: Introduction :- Fertilization refers to the union of a haploid male gamete (spermatozoa) with an…
Q: How is processing food an application of biotechnology?
A: * Biotechnology in food processing makes use of microorganisms for prevention of food and for the…
Q: Examine whether the statement "Human females have 23 different chromosomes, whereas human males have…
A: In their somatic cells, humans contain 23 pairs, or 46 chromosomes. Only 23 chromosomes are present…
Q: 2.1 In your own view, discuss the possible route of transmission of SARS-CoV-2 from an animal source…
A: "Virology" is a field of microbiology that studies many forms of viruses, covering their features,…
Q: Examine whether the statement "Each strand in a ẞ sheet is a helix with two amino acids per turn" is…
A: A polypeptide, or chain of amino acids, makes up proteins. The DNA of organisms codes for 20…
Q: You are a physician and encounter a young 7-year old child with brittle bones due to the lack of…
A: Osteoporesis and Rickets are the disease where the brittle bone phenptype is observed. This brittle…
Q: Match each NICKNAME with the CELL and briefly explain why CELL Dendritic cell Lymph node CD₁ T cells…
A: Introduction Two major immune response is natural (innate) immune response and acquired or adaptive…
Q: Describe RuBisCO
A: A biological catalyst can be described by the term enzyme, which is mainly a protein. It quickens a…
Q: Government recommendations to limit consumption of ________ exist in relation to pushback from the…
A: Dairy products are products that are made from milk like cheese, butter, paneer/cottage cheese. The…
Q: Paramecium Parlor HEY! That's MY enzyme! 0 @AmoebaSisters Whatever. Don't see your name on it.…
A: When molecules that are very similar to the substrate molecules bind to the active site, they hinder…
Q: (True/False) Scientists have now been able to use the genomic data to determine whether a particular…
A: Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…
Q: How would you detect the SNP?
A: SNP -Single nucleotide polymorphism A single nucleotide replaced with other nucleotides in…
Q: CG islands are thought to have arisen during evolution because they were associated with portions of…
A: A short DNA segment known as a "CG island" has a higher frequency of the sequence "CG" (cytosine…
Q: O Sex-linked Recessive
A: Pedigree: It shows the relationships between family members. It indicates which individuals have…
Q: What are 3 benefits members of Kingdom Monera provide to humans?
A: The Kingdom Monera includes prokaryotic organisms such as bacteria and mycoplasmas. Whereas many…
Q: Assume a single base in a RNA virus has a mutation rate of 1/1000 per generation. Over the course…
A: If a random variable has binomial distribution with number of trials n and probability of each…
Q: Please answer asap, thank you! 1. How is life diversified? 2. Identify important characteristic…
A: The variety and variability of life on Earth are said to as biodiversity or biological diversity.…
Q: 3 benefits and 3 costs. Which do you think is more equitable in its impact? (benefit or cost) Why?
A: The benefits of nanotechnology materials are more equitable in their impact than the cost.
Q: Eating healthy is more than the food you eat. In the space below, please list the seven key points…
A: To achieve healthy, balanced diet eat well guides shows the food we take from each of the food…
Q: In which of the following taxa would you find a cavum pulmonale? A) Crocodile B) Mammal C)…
A: Cavum pulmonale is one of the cavities found in the ventricles of heart of one of the taxa of…
Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and ends with a stop codon, so it is only looking at the region of DNA that directly encodes a protein sequence.
5’-AUGCACAAAUUAGAGUACCCCCCAGGAAGGUAG-3’
Make the following mutation in this sequence by changing/adding/removing only one
A frameshift mutation
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13mRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU UCC Leu UCA UCG U UUC UUA UUG CUU C CUC CUA CUG AUU A AUC AUA AUG U GUU G GUC GUA GUG CCU Leu CCC CCA CCG ACU lle ACC ACA Met ACG GCU Val GCC GCA GCG с Second Letter Ser Pro Thr Ala UAU UAC A | AAU AAC AAA AAG GAU GAC GAA GAG Tyr CAU CAC CAA Gin CAG 1 UAA Stop UGA Stop A UAG Stop UGG Trp G His Lys UGU UGC Asp Glu G 3rd Asn AGU Ser U letter AGC AGA AGG Cys U CGU CGC Arg CGA CGG GGU GGC GGA GGG DCAG DUAG DUCAG Arg Gly UCAG
- Second letter C A UUU Phenyl- UUC alanine UCU UCC UAU UAC UGU UGC Tyrosine Cysteine Serine UCA UCG UAA Stop codon UAG Stop codon UGA Stop codon UGG Tryptophan UUA A Leucine UUG CCU ССС CAU CAC CUU CGU CGC Histidine C CUC C CUA Leucine Proline Arginine CCA СCG CGA CGG A CAA CAG CUG Glutamine AGU AGC AUU AAU ААС ACU Asparagine Serine AUC Isoleucine A AUA ACC АСА Threonine AAA AGA Methionine; start codon ACG Lysine Arginine AUG AAG AGG U GUU GUC GUA GCU GCC GCA GAU Aspartic GAC acid GGU GGC GGA GGG Valine Alanine Glycine GAA Glutamic GAG acid GUG GCG G Given the codon UCA in the first exon of a gene, which change is most likely to result in a nonsense mutation? A transversion of A to U Change of nucleotide in the third position Change of nucleotide in the first position A transition of A to G Change of nucleotide in the second position First letter Third letterUsing the Genetic Code Table in Figure 1.3, what is the proper sequence of amino acids in the polypeptide chain based from the given codons of MRNA (3' AAU GCC AGU GGU 5')? * U UUU Phe UCU) UC UCA UCG UAU] UAC Tyr UAA Stop UGA Stop A UAG Stop UGG Trp G UGU U UUC) UGC Cys Ser UUA Leu UUGJ CU) CCU CAU1 CGU His CUC CAC CAA CGC CC Leu CCA Pro Arg CUA CGA A Gin CUG) CG CAG CGG G AUU) ACU) AGU AAU1 Asn AAC, Thr AAA1 U AGC }Ser č A G AUC lle ACC A AUA J ACA AGA AUG Met ACG, AAG}Lys AGG Arg GGU GUU) GUC Val GCU) GCC GCA GCG J GAU1 Asp GACI Ala GGC GGA GGG ) G GUA Gly GAA1 GAG) A Glu GUG) G Figure 1.3 Alanine, Serine, Glycine, Asparagine Serine, Glycine, Asparagine, Alanine Glycine, Asparagine, Alanine, Serine Asparagine, Alanine, Serine, Glycine5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3′ What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU U UUC UUA UUG CUU C CUC CUA CUG U Leu GUA GUG CCU Leu CCC CCA CCG AUU ACU A AUC ACC AUA ACA AUG Met ACG lle UCC Ser UCA UCG GUU GCU G GUC Val GCC с GCA GCG Second Letter Pro Thr Ala A | Tyr UAU UAC UAA Stop UAG Stop CAU His CAC CAA Gin CAG AAU Asn AAC AAA AAG GAU GAC GAA GAG UGU Cys U UGC UGA Stop A UGG Trp G AGU AGC AGA Lys AGG | Asp Glu CGU CGC Arg CGA CGG Arg UCAG ULAG SCAG GGU GGC Gly GGA GGG с Ser U letter 3rd G
- MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Code-End of the Amino Acid MRNA Codons* (anticodon) tRNA Alanine GCU AGA Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid Glutamine Glycine Histidine AAU GAU UGU GAA CAA GGU CAU AUU CUU AAA AUG Isoleucine Leucine Lysine Methionine UUU Phenylalanine Proline CCU UCU Serine ACU UGG Threonine Tryptophan Tyrosine Valine UAU GUA There are 64 codons. Some amino acids have several mRNA codor There is, however, no overlap of codes.Given the genetic code below, enter the correct amino acid sequence for the following RNA sequence: AUG GAG UCC UUG CUG UGA (enter the amino acids as the 3 letter abbreviation on the table separated by dashes with no spaces e.g. Met-Thr-Lys-Glu-Ser) Alanine (Ala) AGUC Tyrosine (Tyr) Valine (Val) GU Cysteine (Cys) START HERE G Arginine (Arg) G Tryptophan (Trp) A C CUGA Serine (Ser) Leucine (Leu) Lysine (Lys) Proline (Pro) Asparagine (Asn) 0406 ACUGACUOROE (na) auone (aug) Giycine (Gly) Serine (Ser) Phenylalanine Glutamic acid (Glu) Aspartic acid (Asp) Histidine (His) Glutamine (Gin) Arginine (Arg) Isoleucine (lle) Methionine (Met) o Threonine (Thr)Table 8.2 Codons in mRNA molecule and their corresponding amino acids UUU UUA GCA AAG GOU O nonsense Oleucine Refer to Table 8.2. UAU codes for which amino acid? O lysine O alanine Phenylalanine UAU leucine UAA alanine lysine valine UCG, UCU O tyrosine AAU UGC tyrosine nonsense asparagine cysteine serine
- MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA Codons* (anticodon) tRNA Alanine GCU Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid AGA AAU GAU UGU GAA Glutamine CAA Glycine Histidine GGU CAU Isoleucine AUU Leucine CUU Lysine Methionine AAA AUG Phenylalanine Proline UUU CCU Serine UCU Threonine ACU Tryptophan Tyrosine Valine UGG UAU GUA * There are 64 codons. Some amino acids have several mRNA codons. There is, however, no overlap of codes. 1. You should be able to fill in the 3-letter "code-end" of the tRNA molecules in the table above. Remember, in RNA A pairs with U, and G pairs with C. There is no thymine. Fill in the table.mRNA sequence of A gene If we have the following mutations, find the type of the mutation (silent or missense or nonsense?) 17CàU 36GàA 49GàU 115AàC 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA GGUAGAAGCCGCUGGGGCUUGGGGCU-3’Refer to the information on the genetic code. Use this information to determine how many amino acids are coded for by the mRNA sequence AUGCGCAGUCGGUAG. The genetic code Second letter of codon UAU UAC JUU Phenylalanine uCU UUC Phe) UUA Leucine (Leu) UUG Tyrosine (Tyr) GCysteine (Cys) UGC 1oStop codon |UGG Tryptophan (Trp) CGU CGC UcC Serine (Ser) UCA ucc CCU cC Proline (Pro) Stop codon UAG Stop codon CAU Histidine His) CU CUC CUA CUG Arginine (Arg) Leucine (Leu) cca CAA CCA CGA Glutamine (Gin) CAG AUU AUC AUA ACU Isoleucine (le) AAU AAC AGU AGC Asparagine (Asn) Serine (Ser) ACC Threonine (Thr) ACA Methicnine ACC start codon GCU Lysine (Lys) AGA Arginine (Arg) ARC AGS GAU Aspartic acid (Asp)G0 GAC GUU GUC Valine (Val) GCC Alanine (Ab) GG Glycine (Gly GUA GUG GCA GCG GA Glutamic acid (Glu) GA GGG GAG 4 15 First letter of codon Third letter of codon