Under which of the following conditions would a lac operon produce the greatest amount of B-galactosidase? The least? Explain your reasoning. Lactose present Glucose p Condition 1 Yes No Condition 2 No Yes Condition 3 Yes Yes Condition 4 No No
Q: All of the following statements about the repressor of the lac operon of E. coli are true EXCEPT…
A: The lac operon is a clustered group of related genes that are transcribed as a single unit. These…
Q: The lac operon regulates expression of genes required for the breakdown of lactose. Use the…
A: The correct answers are 1- RNA polymerase can bind tightly to the lac Z promoter and activate a high…
Q: A researcher was trying to determine whether two molecules (molecule A and molecule B) were co-…
A: CoRepressor - The function of the corepressor is to induce transcriptional silencing or to repress…
Q: Which option is true when considering the regulation of cAMP and the Lac operon. If bacteria are in…
A: Introduction: An operon is a coordinated unit of genetic expression in a bacteria. Jacob and Monod…
Q: Describe the regulation of the lac operon when lactose is present and glucose is present Your…
A: The operon consists of a series of structural gene like Z, Y and A. a segment of DNA called an…
Q: 1. Complete the following table based on your lac operon simulations. Absence of lactose Presence of…
A: An operon is a group of genes that are transcribed at the same time. The lac operon consists of…
Q: Which of the following elements of the lac operon and its associated regulatory factors function in…
A: One of many types of functional regulatory elements are cis-regulatory modules. Regulatory elements…
Q: Which of the following statements about the trp operon is false?
A: From above question the statement If a mutation in region 2 prevents the formation of the 2 + 3…
Q: a mutation that leads to a nonfunctional adenylate cyclase enzyme would lead to what expression…
A: A mutation is a change in the genetic material (the genome) of a cell of a live creature or a virus…
Q: Which of the following conditions is most likely to result in an increase rate of transcription of…
A: Lactose in bacteria is called beta-galactoside which is used as energy and as a carbon source.…
Q: Considering the fec operon described above, under which conditions would the operon be off? Choose…
A: The protein synthesis process is started from the operon region that is actually worked as a switch.…
Q: Which of the following arabinose operon regulatory sites is exclusively involved in the repression…
A: Hi, Thanks For Your Question. Answer : Correct Option Is Ara O2.
Q: In order for the lac operon to be triggered, lactose must be present and ________. a. cAMP levels…
A:
Q: I. CAP-CAMP complex binds to the operator locus blocking the RNA polymerase. II. In the presence of…
A: The lactose operon (also known as the lac operon) is a set of genes that are specific for uptake and…
Q: Consider a mutant of E. coli that has an inactivating mutation in the gene for adenylate cyclase…
A: Introduction :- Inactivating mutations, also known as loss-of-function mutations, cause the gene…
Q: If there was a mutation such that the lac I protein could no longer bind lactose, but could still…
A: Lac operon is responsible for the metabolism of lactose in bacteria.
Q: You are growing E. coli in a laboratory in order to study their operons. The growth media you are…
A: 1. What effect does lactose have on the bacterial cell’s lac operon? Answer:- It induces the operon,…
Q: Match each of the following mechanisms with how it can change the levels of gene products--whether…
A: Operons are DNA segments that include groups of associated genes. They consist of a promoter region,…
Q: Explain how the following conditions will affect the regulation of the operon. Low cAMP levels; E.…
A: Operon is a sequence of DNA that consists of a set of genes which are involved in a particular…
Q: you have a cell that carries mutations in the lac operon repressor gene that render it unable to…
A: The simple concept behind the action of the lac repressor gene is to bind to the lac operon operator…
Q: The glycerol operon has two structural genes that encode the enzymes Amairmerasa and isomerase, as…
A: The usage of carbohydrates as an energy source is dependent on the availability of the concerned…
Q: Choose the best options, by dragging and dropping the colour coded text boxes below, that fill in…
A: Operon is transcription unit of prokaryotic genome with consist of many contiguous structural genes…
Q: High levels of transcription of the lactose operon require all of the following, EXCEPT: A) O the…
A: Lac operon is a gene regulatory mechanism associated with bacterial species while using lactose for…
Q: If the levels of both Glucose and Lactose were low in a bacterial cell, describe the state of the…
A: In bacteria and their viruses, an operon is a genetic regulatory structure in which genes coding for…
Q: Give all possible genotypes of a lac operon that produces, or fails to produce, β-galactosidase and…
A: An operon is defined as a group of genes that have a common promoter and regulator and also…
Q: One way that regulation is often studied is by examining the effects of mute ons. For example,…
A: There are two types of lac mutations occurring in lac operon: 1. uninducible - operon can't be…
Q: The lac operon has 4 genes, I, Z, Y and A. For each scenario, tell me the result of the mutation,…
A: The lac operon is an operon or group of genes with a single promoter. The genes in the operon…
Q: A low level of expression of lac operon occurs at all the time.can you explain the logic behid this…
A: The operon is the group of genes controlled by shared protein. Operons have multiple genes with…
Q: Determine the outcome for the lac operon genotype shown below: I*p*o°z*y /I*p*o*z°x* Assume lactose…
A: A group of genes that are transcribed under a single promoter and an operator is referred to as…
Q: Indicate what protein(s) will bind the DNA in the lac regulatory region of E. coli given the…
A: 1. When lactose as well as glucose are absent then no transcription will take place. The lac operon…
Q: The tryptophan operon is regulated by two methods. Describe in detail the regulation of the operon…
A: Genes are the functional unit of heredity. Operons are a group of genes under a single promoter. The…
Q: According to the operon hypothesis, the Z and Y genes of E. coli are classified as structural genes,…
A: The Lac Operon is responsible for Lactose metabolism and transport in E.coli. This operon consists…
Q: Use the blanks on the left hand side to put the following statements in order (use numbers or…
A: Diauxic growth of Bacterium Also known as Bi - phasic growth. It is a phenomenon in which the…
Q: Consider a mutant of E. coli that has an inactivating mutation in the gene for adenylate cyclase…
A: Introduction The lactose operon (also known as the lac operon) is a group of genes present in E.…
Q: Consider the following scenario: A bacteria cell is surrounded by lactose, but there is no glucose…
A: Lac operon is an operon model takes place in E coli bacteria . It consists of :- A)Promoter B )…
Q: If a researcher moves the operator to the far end of the operon, which of the following processes…
A: An operator is a genetic sequence that helps the DNA sequence to attach proteins in charge for…
Q: Indicate what protein(s) will bind the DNA in the lac regulatory region of E. coli given the…
A: An operon can be defined as a unit of bacterial gene expression and its regulation.It consist of…
Q: High levels of glucose in the environment result in low levels of transcription of the lac operon.…
A: The lactose operon (lac operon) is an operon needed for the transport and digestion of lactose in…
Q: Predict the level of genetic activity of the lac operon as well as the status of the lac repressor…
A: Operon acts as a single regulated unit having one or more structural genes, a promoter gene, a…
Q: You have an E.coli strain in which the lac operon is not expressed when glucose is absent and lacto…
A: The lactose operon (also known as the lac operon) is a group of genes present in E. coli and other…
Q: The trp operon is a repressible operon. A strain of e coli develops a mutation whereby the trp…
A: Repressible genes continues to express themselves till a chemical ( often an end product) inhibits…
Q: You are growing E. coli in a laboratory in order to study their operons. The growth media you are…
A: The prokaryotic gene regulation is known as operon system in which the expression of polycystronic…
Q: Which of the following statements about the lactose operon in E. coli is TRUE? ) It contains the…
A: An operon is a functional unit of DNA (Deoxyribonucleic acid) containing a cluster of genes under…
Q: The trp operon vs. the lac operon: Which one of these is activated in the presence of a substance,…
A: An operon consists of a cluster of functionally related genes that are under the regulation of a…
Q: E. coli is given lactose as a nutrient source. This results in the activation of the lac operon only…
A: The solution to the above mentioned questions is as follows:
Q: For a lac operon of genotype PPO*Z* , functional beta-galactosidase is ... (pick the best answer)…
A: Hi, Thanks For Your Question. Answer : Correct Option Is A (Never produced). I Gene Encodes For…
Q: In the ara operon in E. coli cells, AraC will bind to its specific target DNA when O a. when there…
A: AraC protein can shift from the state of its preference to loop DNA (when arabinose is absent) to…
Q: An E. coli cell as the following genotype for the lac operon system: I- OC Z+ / F’ I+. Which term…
A: The presence I+ repressor is dominant to the absence of a repressor I-. Oc mutants:- these are the…
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- It has been postulated that thiogalactoside transacetylase (LacA in the lactose operon) plays a role in detoxification by acetylating potentially hazardous -galactosides to prevent their absorption after they have diffused out of the cell. How would you put this idea to the test?The following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′The symbols a, b, and c in the table below represent theE. coli lac system genes for the repressor (I ), the operator(O) region, and the β-galactosidase (Z), although notnecessarily in that order. Furthermore, the order inwhich the symbols are written in the genotypes is notnecessarily the actual sequence in the lac operon.Activity (+) or inactivity (−) of Z geneGenotype Inducer absent Inducer presenta- b+ c+ + +a+ b+ c- + +a+ b- c- - a+ b- c+/a- b+ c- + +a+ b+ c+/a- b- c- - +a+ b+ c-/a- b- c+ - +a- b+ c+/a+ b- c- + +a. Which symbol (a, b, or c) represents each of the lacgenes I, O, and Z ?b. In the table, a superscript minus sign on a gene symbolmerely indicates a mutant, but some mutant behaviorsin this system are given special mutant designations.Using the conventional gene symbols for the lac operon,designate each genotype in the table.
- 1. Complete the following table based on your lac operon simulations. Absence of lactose Presence of lactose B-galactosidase permease B-galactosidase permease I*P*O*Z*Y* Mututed ISP+O*ZY* I'P*O°Z*Y* I*P*O°ZYA constitutive mutation in the lac operon may be of several types. [Note that constitutive means that the structural genes are always expressed, even if lactose is absent.] Name two types of constitutive mutations. Group of answer choices LacY- and LacI- LacOc and LacZ- LacZ- and LacI- LacY- and LacA- LacI- and LacOcConsider this strain of E. coli with lac operon alleles: IS pt o* z* y+ /T p* oCz- Y+ In a written response, briefly explain if beta-galactosidase AND permease will be expressed, and if so, will they be inducible or constitutive.
- Use the blanks on the left hand side to put the following statements in order (use numbers or letters to designate the order). All of the statements refer to the diauxic (sequential) growth of a bacterium on the carbon substrates glucose and lactose (see textbook Fig 4.11 on diauxic growth). Remember, the lac operon contains the genes necessary for the lactose catabolism. The glucose substrate is completely consumed, at which time the repressor protein on the lac operon unbinds from the DNA molecule. The lactose substrate is catabolized by the active B-galactosidase enzyme. Glucose, as the preferred carbon substrate, is first consumed by catabolic enzymes that are constitutive (always present). After completion of translation, the B-galactosidase enzyme undergoes folding to form into an active enzyme that can breakdown lactose into its constituent monosaccharides. The messenger RNA code from the lac operon is translated by ribosomal RNAS to form lac-related enzymes, such as…Which of the following lac operon genotypes would allow for functional versions of all the structural enzymes of the lac operon to be expressed constitutively even in the absence of lactose? Group of answer choices I+ O+ Z+ Y+ A+ I- O+ Z- Y- A- I+ OC Z+ Y+ A+ IS O+ Z+ Y+ A+ I+ O+ Z- Y+ A+In the: Mutation of the regulatory region for a repressor protein in the lac operon. Explain: (a) What is the process affected? (b) What is the Effect on the process? (c) Does it affect prokaryotes, eukaryotes or both?
- Based on your knowledge of allosteric regulation, invent and describe a hypothetical mutation that would produce constitutive expression of the Lac operon but is not a mutation that occurs in the Lac operator and is not a mutation to the DNA binding domain of LacI. Clearly mention where in the prokaryotic genome this mutation would occur and explain the logic behind how that mutation would produce constitutive Lac operon expression.What are the effects of the following conditions on Lac operon of bacteria? Do not forget to mention about the role of repressor, activator, RNA polymerase in each case! Glucose is absent and lactose is present Glucose is present and lactose is present Glucose is present and lactose is absentBy using separate labelled diagrams, describe as detail as possile the actions of the normal and mutated lac operon in absence of lactose.