UCAQ UC AG UGA0 UC UCAG GUC UOPO AC Alanine Tyrosine Stop A GU Valine Y Cysteine G A Stop AG AC A G Tryptophan U Arginine Leucine Serine Lysine A UG Proline Asparagine ACU Glutamic Aspartic acid Glycine Phenyl- alanine Leucine acid Serine Histidine Methionine Isoleucine Giutamine Arginine Threonine
Q: What is the main reason for archiving your phage? so that you could repeat the DNA isolation (for…
A: The answer is to store your phage long term so that anyone who accesses the phage database could…
Q: You are studying a pathogenic bacterium which secretes a toxin that affects G protein receptor…
A: The cAMP signaling pathway, commonly referred to as the adenylyl cyclase pathway, is a cell…
Q: 6. a) What is meant by the term "symbiosis"? [K/U] b) Give an example for each type of symbiosis and…
A: Animals breathe in oxygen and exhale carbon dioxide during the process of respiration. Plants, on…
Q: Essay on Circulatory system
A: Introduction The heart, blood vessels, and blood are all part of the blood circulatory system, which…
Q: (iii) Based on the double-stranded DNA sequence of terminator, draw the structure of hairpin loop…
A: Hairpin loop structure It is the secondary structure of mRNA where the complementary base pairing…
Q: which protein consists mainly of a helixes a. hemoglobin d collagen b cotton e…
A: The structure of proteins is organized at four levels. The primary structure shows the sequence of…
Q: For your 25ul ligation reaction: You need to add 160ng of your digested insert DNA (which is at a…
A: Given: Total volume - 25ul. The DNA need to be added is 160 ng. One ul contains 160 ng of digested…
Q: 5. What happens to the population density in a declining po a. It decreases. b. It increases. c. It…
A: Population density can be calculated by three different methods they are arithmetic, physiological…
Q: What cell receptor does adrenaline reach
A: Adrenaline or epinephrine is a hormone released by the medulla of the adrenal glands. It is released…
Q: Which of the following things is/are true about this organism? Phylum Chrodata Subphylum Vertebrata…
A: This organism is Lancelet. Diagrammatic view of lancelet internal structure. Classification of…
Q: 1. In a wild strain of tomato plants, the phenotypic variance for tomato weight is 3.2g². In another…
A: Introduction :- Phenotypic variance is a term that refers to the combination of genotype and…
Q: G. Tactile Location 1. 2. 3.
A: Answer G. Tactile location
Q: Which of the following things is/are true about this organism? invertebrate chordate fish Agnathan…
A: The Arctic lamprey is a little fish that can grow to be over 15 inches long but is usually much…
Q: Starting Molecule(s) Identify the molecules involved for each step in the process
A: Glycolysis = glucose to pyruvate pathway. TCA = tricarboxylic acid cycle ETC = electron transport…
Q: Which of the following mutations in the Gas subunit of the GPCR pathway for glycogen breakdown in…
A: GPCRs are a large family of cell surface receptors that respond to a variety of external signals.…
Q: Distinguish the following phyla by their characteristics and features. Give a specific example for…
A: Animals are classified on the basis of various fundamental features like level of organization,…
Q: 5) cranial nerve II, the optic nerve sends nerve impulses to the brain carrying information about…
A: It is critical to learn and know the anatomy and physiology of the human body. Many changes in the…
Q: Gibberellins have variety of effects such as ___________, _________ and ___________.
A: Answer
Q: Match the letter to the appropriate bone. Im A d Im
A: Introduction:- The core framework of body is the skeletal system.It is composed of bones as well as…
Q: The normal flow of electrons through the electron transport chain is blocked by sodium azide. Which…
A: The citric acid cycle and electron transport chain is the aerobic stages of cellular respiration.
Q: Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT
A:
Q: Classification of organisms in the three domains is based on: Cell wall. Nutritional type Cell type…
A: Three Domain System: Carl Woese et al. introduced the three-domain system in 1990, which divides…
Q: Styles raph Lungfishes Amphibians Mammals Tetrapod limbs Lizards and snakes Amnion Crocodiles…
A: A tree like or comb like taxonomic relationship among different group of organisms is called…
Q: Explain why this statement is true, using phylogenetic and morphological evidence. Tunicates…
A: Tunicates are transparent or brilliantly colored marine animals that are found on the dock pilings,…
Q: Draw the mechanism for 5’ capping of mRNA by the associated enzymes (RNA Triphosphatase, RNA…
A: Capping is done in eukaryotic mRNA to prevent the degradation from nucleases. It also assists in…
Q: Explain the signaling steps that take place after the EGF receptor is dimerized, up to the poiunt…
A: As per our company guideline we are supposed to answer only first question or only first 3 subparts…
Q: Explain how viruses differ from living organisms.
A: A virus is an infectious microorganism made up of a nucleic acid segment (DNA or RNA) that is…
Q: Question: Match the following terms with their meanings from the drop down menus. Water potential…
A: Introduction Cell transports are the movement of a substance through the cell membrane. The…
Q: Ecosystems and Biomes. Answer the following below: A. Describe the climate of each Biome…
A: Introduction Ecology:- It is a branch of science concerned with the study of the environment and…
Q: Which of the following list places the important evolutionary innovations in the correct order of…
A: ANSWER) (d) Notochord - vertebrae - jaws - bony skeleton - lobe fins - internal nares Notochord -…
Q: primer
A: PCR- it stands for the polymerase chain reaction. it is used to make many copies of a specific…
Q: Describe how Separase, plays a critical role during meiosis and mitosis.
A: Introduction Mitosis and meiosis are the two kinds of cell division. When people say "cell…
Q: You are studying a cell line that expresses both GPCR-A and GPCR-B, each receptor binds the same…
A: The G-protein couples receptor signalling is mediated by a seven pass transmembrane receptor located…
Q: What is the role of lactic acid? It is converted to pyruvic acid through glycolysis. It is a…
A: Introduction Lactic acid is an integral part of the human body, it is is a chemical byproduct of…
Q: Tabla 11.2. External comparison of different leaves. Common name o gender 1 2 3 4 5 6 7 8 9 11…
A: S.No Botanical Name Common name Shape of the margin Shape of the foliar lamina Degree of foliar…
Q: Why might the GluR-B mutation prevent calcium from moving through the receptor
A: Glu R- B is the gene that codes for the B subunit of glutamate receptor. When it is formed it is…
Q: You are examining a set of genes from a phage that are transcribed late in infection. You know that…
A: This question is about gene.
Q: Question 2: Consider the following pedigree, which traces the inheritance of a single-gene…
A: Introduction :- A genetic trait or condition can be passed down from parent to child via autosomal…
Q: Which of the following features is NOT helpful in determining the start site of a gene?…
A: Translation: The process through which RNA codes for specific proteins is known as translation. It…
Q: D E- F- Zygomatic Arch Dental Arcade Foramen Magnum Occipital Condyle Occipital Bone [Choose ]…
A: The skeleton of the head is called the skull. It consists of several bones that are joined together…
Q: ic Variation and Evolution Mastery Quiz ay 2 at 2:40pm Instructions Question 1 1 pts In Mendel's…
A: In monohybrid cross of Mendel's experiments : Dominant = TT Heterozygote = Tt Recessive = tt
Q: Based on the Cytochrome C data, which organism is most closely related to humans? 2. Do any of the…
A: Answer
Q: Briefly explain the generation and conduction of nerve impulse.
A: Introduction The nervous system is one such system that regulates and organises the entire body's…
Q: Explain the figures below in detail, this is about baroreceptors Baroreflex Disturbance Response 1.0…
A: Baroreceptors They are mechanoreceptors found in blood arteries around the heart that detect the…
Q: Two homologous chromosomes in ES cells are depicted below with the portion of your gene of interest…
A: CRISPR/Cas9 creates specific double-stranded breaks at the target locus that trigger DNA repair…
Q: Gibberellins acts in concert with _______________ to promote stem elongation
A: Plant hormones or phytohormons are released from specialised tissue in the plants and responsible…
Q: Ashu did a titer assay with her phage lysate. She started with 100µL of phage lysate (10) and did 7…
A:
Q: Define death in physiological terms.
A: Death is condition which indicated by permanent stoppage of heart, reapiration, and brain…
Q: Gene A encodes for a protein A which prevents exit from the G1 phase of the cell cycle. You are…
A: Cancer is the uncontrolled cell division that is highly under the control of genes. Cell cycle is a…
Q: 2
A: The ovary is part of the female reproductive system. It is an organ that has ova (eggs). These ova…
Trending now
This is a popular solution!
Step by step
Solved in 5 steps with 1 images
- Saponify this mixed triglyceride with 3NaOHFirst letter U C A UUU UU JUC UUA UUG CUU CUC CUA CUG AUU AUC AUA AUG GUU GUC GUA GUG ] Phenylalanine UCU (Phe) UCC UCA UCG Leucine (Leu) Leucine (Leu) Isoleucine (Ile) Methionine (Met) Valine (Val) CCU CCC CCA CCG b) lysine c) methionine d) tryptophan ACU ACC ACA ACG GCU GCC GCA GCG C Second letter Serine (Ser) Proline (Pro) Threonine (Thr) Alanine (Ala) UAU UAC UAA UAG CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG ] Tyrosine (Tyr) Stop Stop Histidine (His) Glutamine (Gln) Asparagine (Asn) Lysine (Lys) Aspartic acid (Asp) Glutamic acid (Glu) UGU UGC UGA Stop UGG Tryptophan (Trp) CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG ] 1. List the mRNA base codons for the amino acids listed below. 2. a) aspartate: Cysteine (Cys) Serine (Ser) U C Arginine (Arg) A G Arginine (Arg) U C Glycine (Gly) A G U C A G U MCAG АOne of the following glycosaminoglycans is anti-coagulant O Heparan sulphate O Hyaluronic acid O Heparin sulphate O Keratan sulphate O Chondroitin sulfate search
- Explain using 2-3 sentences the biological significance of the following peptides. Ceruloplasmin OxytocinSubjecting this peptide to trypsin would result in L-M-F-V-W-E-Q-A-P-S-P O A. Lys and Met-Phe-Val-Trp-Glu-Gln-Arg and Pro-Ser-Pro OB, Leu-Met-Phe-Val-Trp-Glu-Gin-Ala-Pro-Ser-Pro Leu and Met-Phe-Val-Trp-Glu-Gln-Arg-Pro-Ser-Pro OC. Op. Lys and Met-Phe-Val-Trp-Glu-Gln-Ala-Pro-Ser-Pro Leu and Met-Phe-Val-Trp-Glu-Gin-Arg-Pro-Ser-Pro OE.Drag the labels onto the diagram to identify the anatomical terminology describing body orientation and direction (human a Posterior (caudal) Distal Superior (dorsal) Proximal Inferior (caudal) Anterior (ventral) Posterior (dorsal) Pearson arch
- Which of the two structures, (Betaxolol) or (Sotalol) would be more contraindicated to treat a patient with hypertension and a history of depression, sleep disorders or psychosis? cr -o- CH2-CH-CH2-NH2-CH(CH3)2 -H2C-O-H2C-H2C- Он (Betaxolol) CH- -CH2-NH2-CH(CH3)2 OH Cr H3C-S-HN- (Sotalol)Second letter A UUU UCU) UC UCA UCG UAU UUC Phe UUA Tyr UGU UGCJ Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUG Leu CAUHIS CUU CUC CUA CUG CCU* C ССА CCG CGU His САС Leu CGC Arg CGA Pro CAA Gin CGGJ Gln Which amino acid is carried by the TRNA with the anticodon 5'-UCA-3? ACU ACC ACA AAU AAC. AGU AGC AGA AUU Ser Asn AUC Ile A AUA Thr AAA Lys AAG Lys AGG Arg AUG Met ACG GAU GGU] GUU GUC GUA GUGJ GCU GCC GCA GCG GAC Asp Ala GAA GGC Gly GGA Val GAG Glu GGGJ Isoleucine. None-this is a stop codon. Aspartic acid. Histidine. IV. Leucine O V. Third letter UCAG UCAG UCAG First letterdiscuss the absorption spectra of the 3 amino acids Arginine, Leucine and Proline.
- explain the phenylketonuria disease mechanismExplain using 2-3 sentences the biological significance of the following peptides . Glucagon Insulin Glutathione Ceruloplasmin OxytocinNAZO NHZ Ala-Cys-Glu -Tyr - Trp - Lys - Arg - His -Pro-G ly Glu pka 4.15 SH Tyr 10.10 Draw Charges Lys 10.67 Olt A3 12.10 +NH₂ Ntrm 2) Calculate net charge 3) write out I letter code 300 Ctim 3 juli of peptich (above) Ⓒ pH; 1,7,12