The sequence shown below is the 5' to 3' strand of a dsDNA template. What are the sequences of the two 18'mer oligonucleotides that you would need as primers for amplifying the underlined region? (Select the binding sites of your chosen primers within the underlined region rather than in the flanking sequence). 5'-AATCCGACCTGATTCTAAAGCGCGCTAAGAGCTACGTAGGCACCCAT GTTGGAAATCTCTTATCGGAGATTTCTTCTTGATTACTGGCCCTATGCATI GTCATTCCATGCCATCGGTATTCTCGATACTTGTACTTGATGCATTCGA-3' Primer 1: 5'- Primer 2: 5'
Q: A microbiologist discovers a new type II restriction endonuclease. When DNA is digested by this…
A: Restriction enzymes are also known as molecular scissors because they cut the DNA at specific, short…
Q: A researcher has isolated a restriction endonuclease that cleaves at only one particular 10-…
A: Restriction endonuclease is an enzyme which cleaves DNA into fragments at specific location sites…
Q: Below is a sequence of DNA.…
A: Introduction :- Adenine (A), thymine (T), cytosine (C), and guanine (G) are four nucleic acid bases…
Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…
A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…
Q: Your graduate advisor asks you to amplify the following sequence of DNA by PCR:…
A: The primer should be complementary to the region of template to be amplified.
Q: You have discovered a family with a new genetic form of anemia. The DNA sequences at the 5’ end of…
A: DNA sequences are transcribed into mRNA sequence, which acts as codons for the amino acid sequence.…
Q: For the chromatogram below, what is the sequence of the template DNA from base 115 to 125?…
A: According to the question, we have to answer the question that which is for the chromatograph below,…
Q: Suppose a single-nucleotide polymorphism occurred in the original strand to make the change shown…
A: INTRODUCTION Single nucleotide polymorphism Single nucleotide polymorphism is the single nucleotide…
Q: Below is a sequence of DNA.…
A: The process of identifying the coding region and the position of a gene in a genome is known as gene…
Q: Why do geneticists studying eukaryotic organisms often construct cDNA libraries, whereas…
A: A cDNA (complementary deoxyribonucleic acid) library is a combination of cloned cDNA fragments…
Q: The following are DNA fragments containing a small gene. The top strand is the coding strand.…
A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…
Q: When half of the DNA in the sample is double-stranded, that point is termed the half- reaction time…
A: Cot values give the renaturation index of the DNA strands. Cot 1/2 value defines that 50%…
Q: How often, on average, would you expect a type II restriction endonuclease to cut a DNA molecule if…
A: Restriction endonucleases are enzymes produced by bacteria that cut the DNA at a specific site known…
Q: a. Write the template DNA (complementary strand) sequence for the wild type gene above b. Write…
A: The coding strand is complementary to the template strand. The template strand is the DNA sequence…
Q: the one above: Replicate this sense strand to create a double-stranded DNA helix…
A: DNA is a double helical structure containing complementary base pairs. Complementary base pairs…
Q: Which of the following pairs of sequences might be found at the ends of an insertion sequence? a.…
A: Insertion sequence (IS) is defined as a short sequence of DNA acting as a transposon (jumping gene…
Q: sing the genetic code provided what would be the corresponding polypeptide sequence for the DNA…
A: The DNA is transcribed into the RNA by the process of transcription and the RNA is translated into…
Q: Human genomic libraries used for DNA sequencing are often made from fragments obtained by cleaving…
A: Genomic Libraries are a set of collections of genomic DNA data particular to a species/organism. The…
Q: sequence shown below is the 5' to 3' strand of a dsDNA template. You are asked to design PCR primers…
A: The polymerase chain reaction (PCR) is a laboratory (in vitro) technique for generating large…
Q: Given the Following DNA template, TAC CGC TCC GCC GTC GAC AAT ACC ACT, write out the…
A: The DNA template is used for the synthesis of mRNA molecules. mRNA molecule is used by the…
Q: For the following five sequences, what is the consensus sequence? 5′–GGGAGCG–3′ 5′–GAGAGCG–3′…
A: Consensus sequences models are most used methods for sequencing base sequences. Consensus sequences…
Q: Please list all possible products in a sequencing reaction using ddGTP as a terminator based on the…
A: 1.As dd GTP is used, every time it encounters C base it will terminate. 2.When C is encountered with…
Q: Template DNA: 5’ ATGACGGAATATAAGCTGGTGGTGGTGG---GGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’ 3’…
A: Template DNA: 5’ATGACGGAATATAAGCTGGTGGTGGTGGGGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’…
Q: Below is a small stretch of DNA in the middle of a gene. What amino acid sequence would be encoded…
A: Amino acids are the organic compounds that contain amino group and carboxyl group functional groups…
Q: TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense…
A: ORIGINAL:- TGAGGATGAAACTCACACCGGGGCGCAAGTTTGGCACTTAGATTCTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT…
Q: Following formation of a double-stranded break, enzymes process the dsDNA end to form…
A: DNA end resection is a key process in the cellular response to DNA double-strand break damage that…
Q: The following DNA sequences were used to generate a contig from a genome sequencing project.…
A: Sequencing It is a method through which the complete genetic makeup of the organism is identified.…
Q: From the following DNA template, which sequence is synthesized by RNA Polymerase? 5’- T – C – C…
A: According to the central dogma of molecular biology, the information stored in DNA is first…
Q: If the DNA duplex for the beta chain of haemoglobin represented by the sequence…
A: Given the template strand in transcription unit is 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5' If the…
Q: If you compare the frequency of the sixteen possible dinucleotide sequences in the E. coli and human…
A: CG directly activates pDCs and B cells. The resultant immune response is characterized by the…
Q: Which of the sequences below would serve as a PCR primer that would bind this DNA strand: 5'-…
A: PCR is polymerase chain reaction. It is a method of DNA amplification developed by Kerry Mullis.…
Q: Please answer ASAP RNA sequencing (RNA-Seq) of one sample in one run of a massively parallel…
A: Next-generation sequencing (NGS) is a massively parallel sequencing technology that offers…
Q: A 2.0kb bacterial plasmid ‘BS1030’ is digested with the restriction endonuclease Sau3A; the plasmid…
A: Plasmids are small, circular, double stranded, and extrachromosomal bacterial DNA. i.e. it is…
Q: When the cDNA was sequenced by the Sanger method utilizing ddCTP, the following products were…
A: Answer :: If the dCTP was not present, the polymerization would come to a standstill, resulting…
Q: In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into…
A: Genome of an organism includes all the cellular DNA of the organism; including nuclear, chloroplast…
Q: The following sequences of DNA would be synthesized using 5′-CAGTTCGGA-3′ as a template: *…
A: DNA is synthesized in 5' to 3' direction.
Q: For the chromatogram below, what is the sequence of the template DNA from base 115 to 125? CTGTGTGAA…
A: DNA is formed of four types of nitrogenous bases, which are adenine, thymine, guanine, and cytocine.…
Q: You have discovered a family with a new genetic form of anemia. The DNA sequences at the 5’ end of…
A: Gene mutations are rare and random changes in DNA sequence which result in alteration of polypeptide…
Q: List the sequences of RNA that would be transcribed from the following DNA template sequences.…
A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. It contain genes that…
Q: The sequence below shows 140bp of a double-stranded DNA sequence coding for histone H2A. What two…
A: PCR or polymerase chain reaction is a rapid and versatile in vitro technique for amplification of…
Q: For the following short sequence of double stranded DNA and the given primers, there will be one…
A: Polymerase chain reaction (PCR) is generally used to produce millions or even billions of copies in…
Q: You purified the genome of the coliphage X174. After analysis, you composition is 25 percent A, 33…
A: E. coli-infecting viruses are known as coliphages. These viruses, in addition to the conventional…
Q: Using the formulae for dsDNA to calculate g/mol: You have a 4110 bp cloning vector Want to ligate a…
A: The average weight of a single DNA bp is 650 daltons. This can also be represented as 650 g/mol (=…
Q: In a dsDNA, a pyrimidine in one chain is always paired with a purine on the other chain because of…
A: Introduction : An organism's DNA is the molecule that holds the genetic information that governs its…
Q: Image 1. Which 2 primers from the choices provided would work to amplify the DNA sequence given…
A: DNA strand for deoxyribose nucleic acid. It is the genetic material present in the cell.
Q: For this double stranded DNA: 3’-AGGTCCAGTCTTCGGCGGATGATCGGGCCAACCCCCGTAACTGGTCACCGGAATGCC-5’…
A: DNA is a double stranded helical structure composed of a template and coding strands. Template…
Q: 5'-AAGCGGGTGTGAGGAGCGCGGCAGCTCAGGTACCCCCGGCCAGGCGCG-3' 31-TTCGCCCACACTCCTCGCGCCGT…
A:
Q: True or False 1. In a dsDNA, a pyrimidine in one chain is always paired with a purine on the other…
A: DNA stands for deoxyribonucleic acid. It is the genetic material of almost all living organisms and…
Q: What are the similarities and/or differences between interpreting Multiple Sequence Alignment (MSA)…
A: Multiple sequence alignment (MSA) is the process or outcome of aligning three or more biological…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- In a standard procedire, when writing and reading base sequences for nucleic acids (both DNA and RNAs) always to specify base sequence in 5' > 3' direction unless otherwise directed 1. From the base sequence 5' A-T-G-C-C-A 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand 2. From the base sequence 5' T-A-A- C-C-T 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strandFor the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show 2 copy cycles of PCR (refer to figure 13.25) for the amplification of this sequence of DNA (so that you have 4 double stranded DNA). 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’6 of 11 The sequence shown below is the 5' to 3' strand of a dsDNA template. You are asked to design PCR primers to amplify the sequence that is in bold and underlined. (Select the binding sites of your chosen primers within the underlined region rather than in the flanking sequence.) 5-CAGTTAACTGGTTATAAGAAACCTGCTTCAAGAGAGCTTAAAGTTACATTTTTCCCTGACTTAAATGGTG АTGTGGTGGСТАТTGATTAТАААСАСТАСАСАСССТСТТTTAAGAAAGGAGCTAAATTGTTACATAAACС-3' What is the 5' to 3' sequence of the reverse primer? O 5-TTC GTC CAA AGA ATA TTC-3' O 5'-CAA TAT TCT TTG GẠC GAA-3' TER O 5-GTT AAA TCG AGG AAA GAA-3' O 5-GTT ATA AGA AAC CTG CTT-3 5'-CAA TTT AGC TCC TTT CTT-3' Assessment Navigator Submit Questionmark Ondemand licensed to University of Dundee 41 MAR étv 30 MacBook Air DII 20 000 F9 esc F7 F8 F5 F6 F1 F2 F3 F4 2$ & ! 7 8. < co 土
- 5'-[seq]-3' The diagram shows the results of gel electrophoresis for Sanger sequencing. The wells are represented by open boxes and the DNA bands are represented by black boxes. The wells are labeled to show which dideoxy reaction was loaded into each. Write the sequence of the original template strand used for this sequencing reaction, with the 5’ end on the left and the 3’ end on the right.6 of 11 The sequence shown below is the 5' to 3' strand of a dsDNA template. You are asked to design PCR primers to amplify the sequence that is in bold and underlined. (Select the binding sites of your chosen primers within the underlined region rather than in the flanking sequence.) 5'-CAGTTAACTGGTTATAAGAAACCTGCTTCAAGAGAGCTTAAAGTTACATTTTTCCCTGACTTAAATGG TG ATGTGGTGGCTATTGATTATAAACACTACÃCACCCTCTTTTAAGAAAGGAGC TAAATTGTTACATAAACC-3' What is the 5' to 3' sequence of the reverse primer? O 5-TTC GTC CAA AGA ATA TTC-3' O 5-CAA TAT TCT TTG GAC GAA-3' 5'-GTT AAA TCG AGG AAA GAA-3' O 5-GTT ATA AGA AAC CTG CTT-3 O 5'-CAA TTT AGC TCC TTT CTT-3'Assume the sequence below is one half of a double stranded DNA template used in a PCR reaction. The highlighted sequences indicate the region bound by primers, either on this strand or on the other complementary strand. 5' ACGTGCGACACGTATATATGTCGCGTGAGTGTAGCGTATCGCTAGAGACGCATACCTATG 3' If the sequence of the forward primer is 5' GCGACACG 3', which of the following sequences would represent the reverse primer? a. 5’ – CAGAGATCGC – 3’ b. None of these sequences would represent the reverse primer c. 5’ – GTCTCTAGCG – 3’ d. 5’ – GCGATCTCTG – 3’ e. 5’ – CGCTAGAGAC – 3’
- There are numerous methods for sequencing DNA, including classical Sanger sequencing, automated Sanger sequencing, and next-generation sequencing technologies, including Illumina technology. Match the modified cytidine nucleotide triphosphates (NTPs) with DNA sequencing methods that utilize them. Classical Sanger sequencing HO-P=O O HO-P=O O HO-P=O O Automated Sanger sequencing -NH₂ CH3 H₂CN ° ? ?N HOOOO OH OH OH NH CH₂ Next-generation DNA sequencing (Illumina) CH₂ NH₂ Answer BankRestriction sites of Lambda (A) DNA - In base pairs (bp) The sites at which each of the 3 different enzymes will cut the same strand of lambda DNA are shown in the maps (see figure 3 B-D), each vertical line on the map is where the respective enzymes will cut. A DNA A (bp) 48502 10 000 20 000 30 000 40 000 9162 17 198 B Sal I 7059 14 885 28 338 35 603 42 900 (bp) Hae III 11 826 21 935 29 341 38 016 (bp) 11648 29,624 Eco R1 (bp) 10 592 16 246 28 915 41 864 Figure 3: Restrictrion site map showing the following A) inear DNA that is not cut as reference B) DNA CLt with Sal L C) DNA cut with Hae , D) DNA cut with Eco RI 1. Calculate the size of the resulting fragments as they will occur after digestion and write the sizes on the maps below. Note that linear DNA has a total size of 48 502 bp (see figure 3A). Page 3 of 7 9162 17 198 Sal i (bp) 7059 14 885 28 338 35 603 42 900 Hae I (bp) 11 826 21 935 29 341 38 016 11648 29,624 Eco R1 (bp) 10 592 16 246 28 915 41 8645) The restriction enzyme EcoRI recognizes the DNA sequence GAATTC and makes a staggered cut as shown in the blue figure below: GA ATTC CTTAAG If EcoRI cuts the generic fragment shown below, 2 fragments with "sticky ends" (single-stranded DNA) will result. "XXX.." denotes any combination of nucleotides that flank either side of the sequence. 6 base pairs 8bp's 5-СTGTAGAATІCGTTACGA- 3' 3-GACATCTTAAGCAATGCT- 5 CTGTAG EcoRI Digest AATTCGTTACGA GCAATGCT GACATCTTAA A. Given the sequence in the section of DNA shown below, draw boxes around the fragments that will be formed when cutting this region of DNA with EcoRI and HAEIII at the same time. 5'- GTGGCCATTCTAGCGCCGAATTCGGCAATTACGATCGTAGGCCATCGATGTAATTC -3' 3'- CACCGGTAAGATCGCGGCTTAAGCCGTTAATGCTAGCATCCGGTAGCTACATTAAG -5' B. Give the sizes in base pairs of each of the fragments that will be formed after making the cuts with these 2 enzymes (don't count the nucleotides in the single-stranded parts).
- 1a) When performing classical Sanger or "dideoxy" sequencing, you set up 4 parallel reactions per template to be sequenced from a specific primer, with each of the four reactions containing a different dideoxynucleotide, and then the four reactions were run in a separate, adjacent lanes on a gel. Why couldn't you combine all 4 dideoxynucleotides with the primer and the template and do the whole reaction in one tube, and then run the set of fragments produced by the reaction mixture on a single lane in an acrylamide gel?12:49 0 14. You want to amplify the DNA between two stretches of sequence shown in the figure below. Explain which one of the following primer pairs would allow you to amplify the DNA by PCR. DNA to be amplified 5'-GACCTGTGGAAGC -CATACGGGATTGA-3" 3'-CTGGACACCTTCG GTATGCCCTAACT-5" primers (1) 5'-GACCTGTCCAAGC-3 (2) 5-CTGGACACCTTCG-3 (5) 5-CATACGGGATTGA-3" (6) 5°-GTATGСССТААСТ-3° (3) 5'-CGAAGGTGTCCAG-3' (7) 5'-TGTTAGGGCATAC-3" (4) 5'-GCTTССАСАGGTC-3° (8) 5'-TCAATCCCGTATG-3' END 5 THE ENDHomologous Recombination, Heteroduplex DNA, and Mismatch Repair Homologous recombination in E. coli leads to the formation of regions of heteroduplex DNA. By definition, such regions contain mismatched bases. Why doesn’t the mismatch repair system of E. coli eliminate these mismatches?