Answered: The response. B cells, humoral O T…

The response. B cells, humoral O T cells, humoral produce antibodies as part of the O macrophages, cytotoxic B cells, cell-mediated immune

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter34: Immunity

Section: Chapter Questions

Problem 13SA

See similar textbooks

Related questions

Q: Background: There are ten major phyla that represent the invertebrate animals. Though they all share…

A: The answer is not based on the lesson you have mentioned but the answer is from general knowledge.…

Q: The principles of biomimicry and bioinspiration have been used to design and to engineer…

A: To cope with the complexity of the body and to evade the multiple layers of defense that tissues and…

Q: 2. Using a reference, find the function of smooth muscle tissue in humans and one would find it.…

A: The hollow body organs like the bladder, colon, and stomach all contain smooth muscles. They are…

Q: Explain what this definition of an organ means “an organ is a collection of many tissues working…

A: Humans and many other complex organisms require unique systems to carry out various functions within…

Q: What is the one cell type that does the most to coordinate and control the adaptive immune response?

A: The immune system's adaptive immune system, sometimes referred to as the acquired immune system, is…

Q: 1. Write down the 5-digit code for this organism. 2. What is the name of the device used to get this…

A: Microorganism identification is a crucial aspect of many microbiologists' work. For example,…

Q: How do virus infection and chemicals may cause cancer? Give examples and mechanisms.

A: A virus can only replicate and create new viruses by entering a live cell and taking control of the…

Q: Can we just insert a gene on an organism? - In plants, the use of Agrobacterium, we're there any…

A: Transfer of genes is a common component of genetic engineering projects, i. e. DNA transfer between…

Q: In low to middle-income countries, the risks of disease from environmental factors are high for…

A: Low- and middle-income nations bear a disproportionately large portion of the burden of diseases…

Q: Are cells grown in the laboratory will function similarly when transplanted?

A: The smallest component that makes up living organisms is called a cell. It is made up of the cell…

Q: There are several factors that contribute to high fidelity of DNA replication. Which of the…

A: To preserve genetic integrity and to ensure genetic continuity, DNA that is transferred to daughter…

Q: : What role does the environment play in addressing the needs of society? Question 2: Do you…

A: Q1 Environment can be summed up as the effects of all the living and non living…

Q: Finally, you assess the whole skeleton for trauma and find 3 fractures and a gun shot wound. What…

A: The human skeletal system consists of 206 bones. Of these 80 bones belong to the axial skeleton…

Q: Use the following information to answer the next question. Small Segment of DNA Uracil Adenine 2…

A: DNA and RNA are the nucleic acid.The monomers of nucleic acid is the nucleotides.Nucleotide is…

Q: The 02 to be utilized by the mitochondria of all eukaryote cells is produced by A) Oxidative…

A: Mitochondria is the cell organelles, found in most of eukaryotes. Mitochondria perform aerobic…

Q: Use the following information to answer the next question. A Venn Diagram Showing the Relationship…

A: All the hereditary information is passed from one generation to another via genetic combinations.…

Q: Put the steps of the process of signal transduction in the order they occur (hint - try to decide…

A: The receptors have site for binding of specific ligand. The receptors are of two types: Membrane…

Q: 1. Differentiate the genotype and phenotype of a cell. 2. If deoxyribonucleotides that lack the…

A: In an organism the genetic matter is present inside the genes present in the chromosome of the…

Q: Describe the structure and composition of viruses. What are three reasons that they are different…

A: In nature there are many ultra microscopic particles known as viruses. A virus is small particle…

Q: Drugs and other medecine uses the concept of signaling. Cite some drugs how they mimic natural…

A: Many drugs mimic cell signalling molecules thereby stimulating cell function and compensate for…

Q: A blood sample is drawn in NaCitrate. The platelet count on an automated instrument is 305,000/UL.…

A: A platelet count from blood drawn into a sodium citrate tube is multiplied by 1.1 to account for the…

Q: Discuss various alternative treatment methods to overcome drug resistance

A: Drug resistance is a condition in which the effectiveness or therapeutic effect of the drug…

Q: STR markers: are point mutations detectable by DNA sequencing are variations in the number of…

A: STR markers, also known as short tandem repeat markers, are regions of DNA that contain a pattern of…

Q: Eukaryotes have very different mRNA processing than prokaryotes do. Please check all that are…

A: Gene expression involves two processes that is- transcription and translation. Transcription is a…

Q: Both d) and e) answers are marked wrong by professor:((

A: A jellyfish comes in a variety of colours, forms, and sizes. The majority of the world's oceans…

Q: Some hospitals concurrently review records for deficiencies others review retrospectively. Explain…

A: Some hospitals simultaneously check records for errors while others do so retrospectively,…

Q: In the cnidaria the ectoderm cells are important because they can react to a stimulus (light) from…

A: Cnidaria possess two layers, endoderm and ectoderm. The gastrodermis, or inner lining, is formed by…

Q: Question 38 All vertebrate animals are bipedal, amniotes chordates, mammals chordates, mammals…

A: Introduction Animals are multicellular, eukaryotic, and heterotrophic living things. The majority…

Q: What occurs during food digestion? Energy in large molecules is used to make ATP. Energy from ATP is…

A: Digestive system is the system in our body which help in digestion and absorption of food , it…

Q: What materials used for bioprosthesis heart valves (the chemically pretreated heart valves)?

A: Prosthetic valves are used to replace diseased or non-functional or dysfunctional heart valves. It…

Q: a. Explain the purposes of tissue fixation and tissue staining. b. Identify the factors that affect…

A: In this answering session the questions a and b will be addressed, as rest of the questions are…

Q: DNA is alway DNA mRNA 5' aal 3 51 PROMOTER AACGCATACGGGATAGCGCCCTGGTTCAAATGGCGGGCCGGCATCCC…

A: One of the core concepts of molecular biology is the flow of information from DNA to RNA to…

Q: Describe the body’s natural defenses in each of the body systems. Identify the role played by the…

A: The human body has its natural defenses which protect the body from various barriers and external…

Q: show me what the clade of banana and grape would look like

A: The term clade is associated with a collection of all the living and extinct members of that…

Q: Distinguish between the innate and adaptive immune systems in terms of cell types used, how they…

A: Innate and adaptive immunity are the 2 main type of immunity , innate immunity is by birth and…

Q: the evolution of complex animals is associated with the Annelids ( Earth worm), the mollusk (clam),…

A: Introduction Protostomes , Deuterostomes ,Cnideria and Proifera are different organism categories…

Q: Explain how Ethnic Origin (regional ancestry) can be determined from bone but not “Race”. Explain…

A: Answer : Ethnic Origin (regional ancestry) can be determined from bone but not “Race” by clearly…

Q: using environmental DNA (eDNA), instead of traditional field-based capture techniques, to study…

A: e DNA or environmental DNA is the presence of DNA of an organism in a particular region. Each and…

Q: What are the dissimilarities between polyalphabetic and monoalphabetic ciphers?

A: Forensic science is involved with the gathering and evaluation of physical evidence as well as other…

Q: there may be more than one correct answer). which of the following options would increase the…

A: Inbreeding depression is characterized by a decline or loss of fitness and strength that is mostly…

Q: Use the following information to answer the next question. Some Events that Occur During Meiosis 1…

A: There are two kinds of cell division: mitosis and meiosis, mitosis is the most common way of making…

Q: What color is the alpha gene spot on the microarray? Answer: Yellow please explain why is the…

A: The microarray can be described as a lab-on-a-chip. It can be used to detect the expression of…

Q: What is epidemiology? there are several ways pathogens can be transmitted including direct contact,…

A: Pathogen can be defined as an organism or agent which is able to cause disease in the…

Q: What occurs during food digestion? Energy in large molecules is used to make ATP. Energy from ATP is…

Q: DNA and Replication Directed Re Chapter 6.4- Traits, Genes, and Alleles (p.174) 1. What is a gene…

A: 1. Gene is a distinct sequence of nucleotides constituting a chromosome, the arrangement of which…

Q: can you please label on the image i have provided

A: The nucleus is present within the cell and constitutes chromosomes. Connective tissue is responsible…

Q: four main types of tissues on of

A: Tissue: It is defined as the group of cells which are having similar shape and specific function.…

Q: Distinguish between skeletal, smooth, and cardiac muscle in terms of location and whether they have…

A: Introduction:- A tissue is defined as the group of cells that have similiar structure and functions…

Q: 1a) Name the start codon and the three stop codons for translation. 1b) What amino acid is…

A: An mRNA codon is a triplet or triple-nucleotide sequence that codes for a certain amino acid during…

Q: Question 6 What is the complementary DNA sequence of this sequence of DNA: 5'-GTTCCCATG-3'? O…

A: Introduction:- DNA ( Deoxy-ribonucleic acid) is a polymer of deoxy-ribonucleotide units, they are of…

Concept explainers

Immunology

Immunology is the division of science involved with the immune reactions occurring in living organisms. The organisms are accustomed to evolving internal defense mechanisms to evade the invasion of microbial pathogens. Diverse cells are connected with stimulating the immune responses, which produce inhospitable conditions to the microbes prompting their lysis and thus inhibits the multiplication of the pathogens. The immune system can distinguish the pathogens through the aid of cellular intercommunication and launch responses to destroy them.

Question

The
response.
O B cells, humoral
O T cells, humoral
produce antibodies as part of the
O macrophages, cytotoxic
O B cells, cell-mediated
immune

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which of the following leads to the redness of inflammation? increased vascular permeability anaphylactic shock increased blood flow complement activation
T cells andB cells. Put a check () mark in the table spaces below if the characteristic indicates the lymphocyte type. Put a cross (*) mark if III. otherwise. Characteristics T cell В сell Originates in the bone marrow May give rise to plasma cells Immunocompetence happens in bone marrow May give rise to memory cells Include regulatory, helper, and cytotoxic cells Responsible in directly attacking virus-infected cells Produces antibodies Effective against extracellular pathogens Immunocompetence happens in thymus gland Effective against intracellular pathogens Holds a surface meceptor capable of recognizing a specific antigen
Explain the process of B cell clonal selection (remember to mention the cells originated in this process with their functions).
. Describe how the immune responses to bacteria and viruses differ, making sure to refer to the defining innate, humoral and cellular immune components of each.
production e. basis of secondary allergy immune response f. nonprotective immune response CRITICAL THINKING New research suggests a link between some microbes that normally live in the body and seemingly unrelated major illnesses. The gum disease called periodontitis itself is not life-threatening, for instance, but it is a fairly good predictor for heart attacks. Bacteria that cause gum disease can trigger inflammation. Thinking back to your reading in Chapter 7, how do you suppose that this response also may be harmful to the heart? 1.
Suggest some reasons that there is so much redundancy of action andthere are so many interacting aspects of immune responses.
Take-home assignment: Please name the type of hypersensitivity AND describe the cause, immune agent involved, symptoms, and treatment strategies. ADCC Allergen FceR Immune complex for IgE Sensitized T cell Allergen- specific IgE FéeR Complement activation cytotoxic Cytokine Surface cell Target antigen cell Complement CA activation Neutrophil Degranulation CAlergy) Tissue Immune complex damage Activated macrophage A В
White pulp: Constricts ut immuneceliscnde helo ke im Cancer Complete the following table with information on two types of specific immunity.. Cell-mediated Immunity Antibody-mediated Immun Турes of lymphocytes involved: Site of lymphocyte maturation: Mode of action: KE THE CONNECTION ncer spreaas throush tee umphatic susteme Sw ent with a history of tonsillitis 4 weeks before coming to the clin Explain the role that the lymphatic system plays in the metastasis of cancer. Elaw
i. Draw a schematic diagram of a typical IgG molecule and label each of the following parts: H chains, L chains, intrachain disulfide bonds, hinge, Fab, Fc, and all the domains. Indicate which domains are involved in antigen binding.
Discuss the processes of B cell sensitization, activation, and differentiation, describe the structure and function of antibodies, and explain the primary and secondary immune responses to antigen exposure.
Compare and contrast Complement with Immunoglobulins. Include a discussion comparing the four functions of each, comparing and contrasting as you discuss, as well as which immune response each is responsible for being a part of.
:= Adaptive immunity (choose all that apply) i Multiple answers: Multiple answers are accepted for this question Select one or more answers and submit. For keyboard navigation... SHOW MORE ✓ a b с Question 4 Homework Unanswered d e f Is present at birth Is a generalized response Is highly specific Relies on antibodies Involves B cells and T cells Occurs within hours of exposure to a particular pathogen