The International Union for the Conservation of Nature and Natural Resources (IUCN), has declared 418 animal species in the Philippines to be threatened: meaning they are either vulnerable, endangered, or critically endangered. As a learner, what small steps that you can do to save these animals
Q: Consider the following image - the dotted lines represent hydrogen bonds between nitrogenous bases:…
A: There are two different type of nucleic acids and these are DNA and RNA. Four different types of…
Q: What are the checkpoints in the completion of the life cycle of nematomorphs? Would it be easier if…
A: The phylum Nematomorpha (also called horsehair worms) is constituted of orders: Nectonematoidea…
Q: Armadillos spend a lot of time digging in soil to find insects and plant roots to eat, as well as to…
A: Digging is considered as a major type of activity in armadillos life because its their habit to dig…
Q: which germ layer (tissue) gives rice to our nervous system and outer coverings. a) endotherm b)…
A: The mesoderm, or middle tissue, gives rise to most of the muscle and connective tissues. Finally the…
Q: All of the following describe a gamete, EXCEPT: a) sperm b) haploid c) zygote d) egg
A: Gametes are an organism's reproductive cells. They are also referred to as sex cells. Female gametes…
Q: Why are parasitic infections of nematodes still common despite our understanding of their biology?…
A: The parasitic can reside in the human body's small intestine. They reproduce by laying eggs and…
Q: What is special about the coloring of most tinamou eggs? 2. What ability do tinamous have that…
A: 1. The colour of the tinamou's eggs is due to the interplay between pigment coloration and what is…
Q: The mechanism of activation of eukaryotic genes involves addition and removal of phosphate residues…
A: The eukaryotic system has a general trend of activating anything by phosphorylation and vice versa.…
Q: egmentation O Can be fused into specialized functional regions Is seen in insects, worms, and their…
A: The sequence repetition of similar organs, tissues, cell types on different body segments placed on…
Q: If an experimental design includes systematic variation it means that: O Changes in only one…
A: ANSWER;- Across experiment units, independent variables are changed in such a way that the separate…
Q: Cuvier's idea of catastrophe related to asteroid collisions understanding that geological change…
A: Theory of catastrophes by George's Cuvier According to this theory, fossil show that animal and…
Q: Which of the following type of placenta is found in humans? a) Discoidal b) Zonary c) Diffuse d)…
A: Introduction - During the pregnancy phase, the placenta is an organ that grows inside the uterus. A…
Q: Draw this stretch of DNA, showing BOTH strands, using a simplified model of a nucleotide as shown:…
A: DNA is the protein in all living organisms that convey genetic information.
Q: a. Describe the relationship between stimulus voltage and the force of contraction b. What was the…
A: The threshold stimulus voltage is found by varying the stimulus voltage slightly to discover the…
Q: In prokaryotes, the sigma factor recognizes base sequences in the . which facilitates RNA polymerase…
A: The major step of initiation of RNA synthesis is the facilitation of RNA polymerase binding. This is…
Q: true or false: Identical twins are a result of totipotent cells splitting apart after one egg is…
A: Humans are sexually reproducing organisms in which the fertilization and embryonic development…
Q: 10. Modified true or false: Write T if the statement is true; if false, write F, underline the word…
A: Plants are classified as flowering plants and non-flowering plants. Flowering plants are divided…
Q: Question 14 Which of the following is NOT true regarding E. coli replication on the lagging strand?…
A: In case of E. Coli replication of lagging strand: The synthesis is discontinuous and occurs 5' to 3'…
Q: Q.15. State the principle of vaccination. How can vaccines be used to prevent microbial infections?…
A: Introduction In this question we have to state the principle of vaccination.
Q: What is a recombinant DNA vaccine? List two such vaccines. State their advantages.
A: Plasmids, which are small circular pieces of DNA, are used in the production of recombinant DNA…
Q: Are plants male female or both? EXPLAIN Please answer asap and your content should not be palgarised
A: The term "plant" refers to a diverse group of living organisms that all belong to the Plantae…
Q: 1. A certain mRNA codon is determined to be AUG. a. What is the tRNA anticodon? b. What is the DNA…
A: Transcription is the transfer of genetic information from sequence of DNA to RNA, Transcription…
Q: In goats, the gene for coat color is on an autosome and light brown color is dominant to black. A…
A: Let the gene determining the same be B/b So light brown male is BB Dark brown female is bb BBX bb Bb…
Q: Question 33 RNA polymerase II: A is located in the nucleoplasm and transcribes the protein-encoding…
A: Transcription is the process which is required for formation of mRNA from template strand of DNA.
Q: Describe one characteristic you see in organism 3 which might have had an advantage over organism 2.…
A: *Darwin proposed that Fossil records provides evidence that the living organisms has evolved a…
Q: Can two normal individuals of the same species with sexual reproduction have identical genomes and…
A: Introduction - Sexual reproduction is a type of reproduction that comprises a complicated life cycle…
Q: What type of tissue is this?
A: Connective tissue, epithelial tissue, muscular tissue, and nerve tissue are the four main forms of…
Q: Q4.1. The image below shows a neuron's response to a medium-intensity stimulus. Which of the options…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Thomas, a 62-year-old man, is experiencing pain in his left chest and left arm. When he reaches the…
A: Introduction A heart attack occurs when blood flow to a part of your heart stops, one or more of…
Q: Which of the following is not an example of homeostasis? Changing temperature Constant blood…
A: Homeostasis It is defined as the state of constant internal conditions( physical and chemical)…
Q: What are homologous chromosomes? Which are the human cells that do not have homologous chromosomes?
A: Introduction - Chromosomes are thread-like structures that reside within the nucleus of animal and…
Q: Name the four classes of bones? a) Long, short, regular, irregular b) Big, small, flat, bulged c)…
A: Bone is a mineralized connective tissue . The matrix of bone is made up of calcium and phosphate…
Q: Which type of molecule binds at the core promoter sites in association with RNA polymerase? A…
A: RNA polymerase can attach to the polymer by only one method. This method involves binding of Basal.…
Q: A 3-point test cross produces the following numbers of offspring: + + a 348 How many double…
A: Test cross is a cross made between f1 (offspring)with its recessive parent to identify the dominance…
Q: In terms of feeding strategies, do you think a large priapulid is more efficient than a small one?…
A: Priapulid are referred to as penis worms because of their structural morphology similar to the male…
Q: Which of the following disaccharide repeats is the most stable towards hydrolysis?…
A: Hydrolytic stability is the resistance of a cured polymer material to reverting to a semisolid or…
Q: Glucocorticoids are __________ hormones secreted by __________ glands. Multiple Choice peptide;…
A: Glucocortioids are the hormones that is used for the treatment of the inflammation, autoimmune…
Q: Do phylogenetically proximal species have cells with proximal chromosome counts?
A: Introduction - The idea of phylogenetic species (PSC) The idea of a species as an irreducible group…
Q: Illustration of stages in Meiosis 2 with 10 chromosomes, explain briefly
A: Meiosis is a type of cell division that occurs in sex cells at the time of gamete formation. It…
Q: What are the species of aerobic bacteria which can be found in chronic wound?
A: Introduction A wound is an injury that occurs quickly and involves lacerated or punctured skin (open…
Q: Abacteria isolated from Yellowstone National Park is found to use the chemical methane as a food…
A: Chemotrophs are organisms whose energy source is obtained by the oxidation of inorganic…
Q: An individual with an argininosuccinase deficiency is administered benzoate and arginine. This…
A: Argininosuccinase deficiency is a condition where the cells are devoid of an important enzyme i.e.…
Q: Define the words phylogeny, phylogenetic tree and systematics
A:
Q: A 3-point test cross produces the following numbers of offspring: The yellow cells are the…
A: The three point test cross data is given in the question. The three genes are involved in a three…
Q: In cell growth, how does the normal allele of BRCA1 work? Is it an oncogene or a tumor suppressor…
A: Cell growth is a very complex and orderly process in which various enzymes cell signaling pathways…
Q: Match the subfamilies of HSPGS withe their examples v syndecans and CD44V3 A. Secreted ECM…
A: Proteoglycans are mucoproteins that are formed of glycosaminoglycans that are covalently attached to…
Q: Q.4. Explain why excessive dosage and abusive usage of drugs such as amphetamines, LSD and…
A: Effects of drugs on human :- Seizures, stroke, mental confusion and brain damage. Lung disease.…
Q: Name the four classes of bones? a) Long, short, regular, irregular b) Big, small, flat, bulged c)…
A: * Skeleton is the framework of human body which is composed of 270 bones at birth and can be…
Q: explain also.
A: PABP (Poly A binding protein) is a RNA binding protein which triggers the binding of eukaryotic…
Q: using, 3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error…
A: The given sequence is 3'TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG5' The mRNA sequence will be…
Step by step
Solved in 2 steps
- Is the following case study an r-strategists or a K-strategists? Andean condors reach sexual maturity at five to six years. Reproduction is slow; females lay only one or two eggs every other year. Offspring are cared for by both parents for at least one year. Andean condors are long-lived and can survive for seventy to seventy-five years.Research about the saber-tooth tiger. a. species of animal b. location of animal (state or country) c. the animals status (extinct, endangered, threatened, etc.) d. reason for status (why is animal extinct, endangered, threatened, etc.) e. type of habit need for survival f. conservation efforts on the animals behalf g. prospects for the future of this animal#1 endangerered or threatened animal is Javan Rhinos write a summary on Javan rhinos considering answering these questions.
- Insects are the largest group of animals on Earth. Insect diversity is greatest in the tropics, where habitat destruction and species extinction are occurring at an alarming rate. What biological, economic, and ethical arguments can you advance to persuade people and governments to preserve this biological diversity? Instructions:There are three chief ideas of the handicap principle: 1) Animals communicate with éach other throughn sigi must be honest, and 3) honest signals are expensive. Stotting behavior (up and down jumps gazelles exhibit when they spot a predator before the gazelle runs away) often results in the predator leaving before it attacks, presumably because the predator knows it won't easily catch that gazelle. This clearly is an example of the handicap principle based on the three ideas. True FalsePrairie dogs are small mammals that live in large colonies in burrows in the ground. Prairie dogs that are near their own relatives when a predator approaches are much more likely to issue a warning bark than those that are near unrelated prairie dogs. The prairie dogs that hear a warning bark are more likely to hide in their burrows than to remain above ground. However, the prairie dog that gives the warning bark is putting itself at increased risk of being identified and killed by the predator. Which of the following presents the most likely evolutionary explanation for the behaviors described? a) The barking prairie dog chooses to warn other prairie dogs, leading to more prairie dogs living above ground. b) The failure of the individual to bark when surrounded by unrelated prairie dogs ensures survival of the individual. c) The barking prairie dog is alerting unrelated prairie dogs to the predator, so it is not giving any advantage to its own relatives.…
- Prairie dogs are small mammals that live in large colonies in burrows in the ground. Prairie dogs that are near their own relatives when a predator approaches are much more likely to issue a warning bark than those that are near unrelated prairie dogs. The prairie dogs that heara warning bark are more likely to hide in their burrows than to remain above ground. However, the prairie dog that gives the warning bark is putting itself at increased risk of being identified and killed by the predator.Which of the following presents the most likely evolutionary explanation for the behaviors described? * d 2 thool The barking prairie dog is alerting unrelated prairie dogs to the predator, so it is not giving any advantage to its own relatives. The failure of the individual to bark when surrounded by unrelated prairie dogs ensures survival of the individual. The warning bark changes the behavior of the related prairie dogs nearby, allowing the prairie dog's t have increased survival and…Please help me answer this in 10 sentences only. In the Convention of Biological Diversity (CBD), the precautionary principle read “when there is a threat of significant reduction or loss of biological diversity, lack of full scientific uncertainty should not be used as a reason for postponing measure to minimize or avoid threat”. What is the application of this principle to straddling fish stocks and migratory fishes? Thank you very much for your helpMuro-ami is a fishing method where the fishes are driven out of a coral reef by pounding the corals with a heavy weight, or simply by breaking the corals. Then the fishes are guided into the nearby fishnets. - Is Muro-ami illegal? Why?- Cite at least two ways by which the different sectors of the society can help in the protection and conservation of fishes.
- Thank you for your help Jaguars are a keystone species in the Amazon. Describe how they can be so essential to the ecosystem despite being significantly less abundant than many other species.Have you ever paid close attention to the animals printed in each paper bill? In what denomination can you find the Philippine tarsier? Maliputo? Whaleshark? The Asian civet cat? The South Sea pearl oyster? Why do you think the Bangko Sentral ng Pilipinas chose to feature these wildlife?Read the paragraph and look at the chart. Then answer the items. 1% 26% Over 30% of the world's frogs and toads have an official 29% status of “threatened" or “near threatened." Much of this is 6% due to capturing frogs and toads for the pet trade, as well as systematic deforestation of their habitats. The oophaga lehmanni, also known as the Lehmann's poison frog or red-banded poison frog, is critically endangered, for example. Its distribution, throughout areas in its native Columbia, is 39% Frogs Extinct 1% Near-threatened 29% scattered and continues to decline. Least Concern 39% Data deficient 28% 1. What information does the pie chart provide? 2. How does the key below the pie chart help you to better understand the pie chart? 3. How does the pie chart support what the text states? 4. Write one fact you learned from the pie chart or the text.